Target Regulator(s) Information (MicroRNA)

Content Navigation (  All   None )                                      
Target General Information
The microRNAs (miRNAs) Regulating This Target
References
Target General Information  Top
Target ID T17339 Target Info
Target Name Dual specificity protein phosphatase 10 (DUSP10)
Synonyms Mitogen-activated protein kinase phosphatase 5; MKP5; MKP-5; MAP kinase phosphatase 5
Target Type Literature-reported Target
Gene Name DUSP10
Biochemical Class Phosphoric monoester hydrolase
UniProt ID
Q9Y6W6
The microRNAs (miRNAs) Regulating This Target  Top
miRNA Mature ID hsa-miR-21-5p miRNA Info
miRNA Mature AC
MIMAT0000076
Sequence uagcuuaucagacugauguuga
miRNA Species Homo sapiens
Regulation Mechanism DUSP10 is a direct target of posttranscriptional regulation mediated by miR-21. [1]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [1]
Representative Target(s) Regulated by This miRNA Apoptosis antigen ligand (CD178) Target Info
TNFL6_HUMAN
Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
References  Top
REF 1 Downregulation of inflammatory microRNAs by Ig-like transcript 3 is essential for the differentiation of human CD8(+) T suppressor cells. J Immunol. 2012 Apr 1;188(7):3042-52.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.