The microRNAs (miRNAs) Regulating This Target |
Top |
miRNA Mature ID |
hsa-miR-10b-5p |
miRNA Info
|
miRNA Mature AC |
|
Sequence |
uacccuguagaaccgaauuugug
|
miRNA Species |
Homo sapiens |
Regulation Mechanism |
miR-10b mimics significantly reduce the protein levels of GP1BA. |
[1] |
Evidence Score (E-score) |
2 |
+ |
1 |
Luciferase Reporter Assay |
[1] |
2 |
Western Blot |
[2] |
Representative Target(s) Regulated by This miRNA |
Cellular tumor antigen p53 (TP53)
|
Target Info
|
|
Cyclic AMP-responsive element-binding protein (CREB1)
|
Target Info
|
|
miRNA Mature ID |
hsa-miR-10a-5p |
miRNA Info
|
miRNA Mature AC |
|
Sequence |
uacccuguagauccgaauuugug
|
miRNA Species |
Homo sapiens |
Regulation Mechanism |
miR-10a mimics significantly reduce the protein levels of GP1BA. |
[1] |
Evidence Score (E-score) |
1 |
+ |
1 |
Luciferase Reporter Assay |
[1] |
Representative Target(s) Regulated by This miRNA |
AN1-type zinc finger protein 5 (ZFAND5)
|
Target Info
|
|
Brain-derived neurotrophic factor (BDNF)
|
Target Info
|
|