Target Regulator(s) Information (MicroRNA)

Content Navigation (  All   None )                                      
Target General Information
The microRNAs (miRNAs) Regulating This Target
References
Target General Information  Top
Target ID T17427 Target Info
Target Name Platelet glycoprotein Ib alpha (CD42b)
Synonyms Platelet glycoprotein Ib alpha chain; Glycoprotein Ibalpha; Glycocalicin; GPIbalpha; GPIbA; GPIb-alpha; GPIb alpha; GP-Ib alpha; Antigen CD42balpha; Antigen CD42b-alpha
Target Type Clinical trial Target
Gene Name GP1BA
UniProt ID
P07359
The microRNAs (miRNAs) Regulating This Target  Top
miRNA Mature ID hsa-miR-10b-5p miRNA Info
miRNA Mature AC
MIMAT0000254
Sequence uacccuguagaaccgaauuugug
miRNA Species Homo sapiens
Regulation Mechanism miR-10b mimics significantly reduce the protein levels of GP1BA. [1]
Evidence Score (E-score) 2 +
1 Luciferase Reporter Assay [1]
2 Western Blot [2]
Representative Target(s) Regulated by This miRNA Cellular tumor antigen p53 (TP53) Target Info
P53_HUMAN
Cyclic AMP-responsive element-binding protein (CREB1) Target Info
CREB1_HUMAN
miRNA Mature ID hsa-miR-10a-5p miRNA Info
miRNA Mature AC
MIMAT0000253
Sequence uacccuguagauccgaauuugug
miRNA Species Homo sapiens
Regulation Mechanism miR-10a mimics significantly reduce the protein levels of GP1BA. [1]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay [1]
Representative Target(s) Regulated by This miRNA AN1-type zinc finger protein 5 (ZFAND5) Target Info
ZFAN5_HUMAN
Brain-derived neurotrophic factor (BDNF) Target Info
BDNF_HUMAN
References  Top
REF 1 MicroRNAs 10a and 10b Regulate the Expression of Human Platelet Glycoprotein Ib for Normal Megakaryopoiesis. Int J Mol Sci. 2016 Nov 9;17(11). pii: E1873.
REF 2 Changes in MicroRNA Expression Level of Circulating Platelets Contribute to Platelet Defect After Cardiopulmonary Bypass. Crit Care Med. 2018 Aug;46(8):e761-e767.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.