Content Navigation
( All
None )
| Target General Information |
Top |
| Target ID |
T18664 |
Target Info
|
| Target Name |
Monoglyceride lipase (MAGL) |
| Synonyms |
Monoacylglycerol lipase; MGL; Lysophospholipaselike; Lysophospholipase-like; Lysophospholipase homolog; HUK5; HU-K5 |
| Target Type |
Clinical trial Target |
| Gene Name |
MGLL |
| Biochemical Class |
Carboxylic ester hydrolase |
| UniProt ID |
|
| The microRNAs (miRNAs) Regulating This Target |
Top |
| miRNA Mature ID |
hsa-miR-142-3p |
miRNA Info
|
| miRNA Mature AC |
|
| Sequence |
uguaguguuuccuacuuuaugga
|
| miRNA Species |
Homo sapiens |
| Evidence Score (E-score) |
2 |
+ |
| 1 |
HITS-CLIP |
[1] |
| 2 |
Microarray; qRT-PCR |
[2] |
| Representative Target(s) Regulated by This miRNA |
ATP-binding cassette transporter G2 (ABCG2)
|
Target Info
|
|
|
High mobility group protein B1 (HMGB1)
|
Target Info
|
|
| miRNA Mature ID |
hsa-miR-93-5p |
miRNA Info
|
| miRNA Mature AC |
|
| Sequence |
caaagugcuguucgugcagguag
|
| miRNA Species |
Homo sapiens |
| Evidence Score (E-score) |
1 |
+ |
| 1 |
Microarray |
[2] |
| Representative Target(s) Regulated by This miRNA |
Angiogenin (ANG)
|
Target Info
|
|
|
ATP-binding cassette transporter A1 (ABCA1)
|
Target Info
|
|
| References |
Top |
| REF 1 |
EBV and human microRNAs co-target oncogenic and apoptotic viral and human genes during latency. EMBO J. 2012 May 2;31(9):2207-21.
|
| REF 2 |
MicroRNA profiling in mucosal biopsies of eosinophilic esophagitis patients pre and post treatment with steroids and relationship with mRNA targets. PLoS One. 2012;7(7):e40676.
|
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.
