Target Regulator(s) Information (MicroRNA)

Content Navigation (  All   None )                                      
Target General Information
The microRNAs (miRNAs) Regulating This Target
References
Target General Information  Top
Target ID T18779 Target Info
Target Name Mucin-1 (MUC1)
Synonyms Tumour-associated antigen mucin 1; Tumor-associated mucin; Tumor-associated epithelial membraneantigen; Tumor-associated epithelial membrane antigen; Polymorphic epithelial mucin; Peanut-reactive urinary mucin; PUM; PEMT; PEM; MUC-1; Krebs von den Lungen-6; KL-6; H23AG; Episialin; EMA; Carcinoma-associated mucin; Cancer antigen 15-3; CD227 antigen; CD227; CA 15-3; Breast carcinoma-associated antigen DF3
Target Type Clinical trial Target
Gene Name MUC1
UniProt ID
P15941
The microRNAs (miRNAs) Regulating This Target  Top
miRNA Mature ID hsa-miR-145-5p miRNA Info
miRNA Mature AC
MIMAT0000437
Sequence guccaguuuucccaggaaucccu
miRNA Species Homo sapiens
Regulation Mechanism The overexpression of miR-145-5p resulted in the decreased protein level of target MUC1. [3]
Evidence Score (E-score) 4 +
1 Luciferase Reporter Assay [1]
2 Luciferase Reporter Assay; qRT-PCR; Western Blot [2]
3 Luciferase Reporter Assay; qRT-PCR; Western Blot; Reporter Assay [3]
4 Luciferase Reporter Assay; Western Blot [4]
Representative Target(s) Regulated by This miRNA A proliferation-inducing ligand (APRIL) Target Info
TNF13_HUMAN
Alkaline phosphatase (ALPPL2) Target Info
PPBN_HUMAN
miRNA Mature ID hsa-miR-1226-3p miRNA Info
miRNA Mature AC
MIMAT0005577
Sequence ucaccagcccuguguucccuag
miRNA Species Homo sapiens
Regulation Mechanism miR-1226 interacts with the MUC1 mRNA 3'UTR and that miR-1226 downregulates endogenous MUC1 protein levels. [5]
Evidence Score (E-score) 2 +
1 Luciferase Reporter Assay [5]
2 Luciferase Reporter Assay [6]
Representative Target(s) Regulated by This miRNA Mucin-1 (MUC1) Target Info
MUC1_HUMAN
miRNA Mature ID hsa-miR-29a-3p miRNA Info
miRNA Mature AC
MIMAT0000086
Sequence uagcaccaucugaaaucgguua
miRNA Species Homo sapiens
Regulation Mechanism miR-29a negatively regulate MUC1 expression by interacting directly with its 3'UTR. [7]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [7]
Representative Target(s) Regulated by This miRNA Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
Aryl hydrocarbon receptor (AHR) Target Info
AHR_HUMAN
miRNA Mature ID hsa-miR-330-5p miRNA Info
miRNA Mature AC
MIMAT0004693
Sequence ucucugggccugugucuuaggc
miRNA Species Homo sapiens
Regulation Mechanism miR-330-5p negatively regulate MUC1 expression by interacting directly with its 3'UTR. [7]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [7]
Representative Target(s) Regulated by This miRNA Integrin alpha-5 (ITGA5) Target Info
ITA5_HUMAN
Mucin-1 (MUC1) Target Info
MUC1_HUMAN
miRNA Mature ID hsa-miR-455-3p miRNA Info
miRNA Mature AC
MIMAT0004784
Sequence gcaguccaugggcauauacac
miRNA Species Homo sapiens
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay [8]
Representative Target(s) Regulated by This miRNA Eukaryotic initiation factor 4E (EIF4E) Target Info
IF4E_HUMAN
Histone deacetylase 2 (HDAC2) Target Info
HDAC2_HUMAN
References  Top
REF 1 MiR-145 is downregulated in human ovarian cancer and modulates cell growth and invasion by targeting p70S6K1 and MUC1. Biochem Biophys Res Commun. 2013 Nov 29;441(4):693-700.
REF 2 Low miR-145 silenced by DNA methylation promotes NSCLC cell proliferation, migration and invasion by targeting mucin 1. Cancer Biol Ther. 2015;16(7):1071-9.
REF 3 MicroRNA-145 suppresses cell invasion and metastasis by directly targeting mucin 1. Cancer Res. 2010 Jan 1;70(1):378-87.
REF 4 miR-145-mediated suppression of cell growth, invasion and metastasis. Am J Transl Res. 2010 Mar 25;2(2):170-80.
REF 5 miR-1226 targets expression of the mucin 1 oncoprotein and induces cell death. Int J Oncol. 2010 Jul;37(1):61-9.
REF 6 The long noncoding RNA MIR210HG promotes tumor metastasis by acting as a ceRNA of miR-1226-3p to regulate mucin-1c expression in invasive breast ca... Aging (Albany NY). 2019 Aug 10;11(15):5646-5665.
REF 7 Micro-RNAs miR-29a and miR-330-5p function as tumor suppressors by targeting the MUC1 mucin in pancreatic cancer cells. Biochim Biophys Acta. 2015 Oct;1853(10 Pt A):2392-403.
REF 8 Changes in microRNA and mRNA expression with differentiation of human bronchial epithelial cells. Am J Respir Cell Mol Biol. 2013 Sep;49(3):384-95.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.