The microRNAs (miRNAs) Regulating This Target |
Top |
miRNA Mature ID |
hsa-miR-145-5p |
miRNA Info
|
miRNA Mature AC |
|
Sequence |
guccaguuuucccaggaaucccu
|
miRNA Species |
Homo sapiens |
Regulation Mechanism |
The overexpression of miR-145-5p resulted in the decreased protein level of target MUC1. |
[3] |
Evidence Score (E-score) |
4 |
+ |
1 |
Luciferase Reporter Assay |
[1] |
2 |
Luciferase Reporter Assay; qRT-PCR; Western Blot |
[2] |
3 |
Luciferase Reporter Assay; qRT-PCR; Western Blot; Reporter Assay |
[3] |
4 |
Luciferase Reporter Assay; Western Blot |
[4] |
Representative Target(s) Regulated by This miRNA |
A proliferation-inducing ligand (APRIL)
|
Target Info
|
|
Alkaline phosphatase (ALPPL2)
|
Target Info
|
|
miRNA Mature ID |
hsa-miR-1226-3p |
miRNA Info
|
miRNA Mature AC |
|
Sequence |
ucaccagcccuguguucccuag
|
miRNA Species |
Homo sapiens |
Regulation Mechanism |
miR-1226 interacts with the MUC1 mRNA 3'UTR and that miR-1226 downregulates endogenous MUC1 protein levels. |
[5] |
Evidence Score (E-score) |
2 |
+ |
1 |
Luciferase Reporter Assay |
[5] |
2 |
Luciferase Reporter Assay |
[6] |
Representative Target(s) Regulated by This miRNA |
Mucin-1 (MUC1)
|
Target Info
|
|
miRNA Mature ID |
hsa-miR-29a-3p |
miRNA Info
|
miRNA Mature AC |
|
Sequence |
uagcaccaucugaaaucgguua
|
miRNA Species |
Homo sapiens |
Regulation Mechanism |
miR-29a negatively regulate MUC1 expression by interacting directly with its 3'UTR. |
[7] |
Evidence Score (E-score) |
1 |
+ |
1 |
Luciferase Reporter Assay; Western Blot |
[7] |
Representative Target(s) Regulated by This miRNA |
Apoptosis regulator Bcl-2 (BCL-2)
|
Target Info
|
|
Aryl hydrocarbon receptor (AHR)
|
Target Info
|
|
miRNA Mature ID |
hsa-miR-330-5p |
miRNA Info
|
miRNA Mature AC |
|
Sequence |
ucucugggccugugucuuaggc
|
miRNA Species |
Homo sapiens |
Regulation Mechanism |
miR-330-5p negatively regulate MUC1 expression by interacting directly with its 3'UTR. |
[7] |
Evidence Score (E-score) |
1 |
+ |
1 |
Luciferase Reporter Assay; Western Blot |
[7] |
Representative Target(s) Regulated by This miRNA |
Integrin alpha-5 (ITGA5)
|
Target Info
|
|
Mucin-1 (MUC1)
|
Target Info
|
|
miRNA Mature ID |
hsa-miR-455-3p |
miRNA Info
|
miRNA Mature AC |
|
Sequence |
gcaguccaugggcauauacac
|
miRNA Species |
Homo sapiens |
Evidence Score (E-score) |
1 |
+ |
1 |
Luciferase Reporter Assay |
[8] |
Representative Target(s) Regulated by This miRNA |
Eukaryotic initiation factor 4E (EIF4E)
|
Target Info
|
|
Histone deacetylase 2 (HDAC2)
|
Target Info
|
|