Content Navigation
( All
None )
| Target General Information |
Top |
| Target ID |
T20017 |
Target Info
|
| Target Name |
CREB-regulated transcription coactivator 1 (TORC1) |
| Synonyms |
WAMTP1; Transducer of regulated cAMP response elementbinding protein 1; Transducer of regulated cAMP response element-binding protein 1; Transducer of CREB protein 1; TORC1; TORC-1; Mucoepidermoid carcinoma translocated protein 1; MECT1; KIAA0616; CREBregulated transcription coactivator 1 |
| Target Type |
Clinical trial Target |
| Gene Name |
CRTC1 |
| UniProt ID |
|
| The microRNAs (miRNAs) Regulating This Target |
Top |
| miRNA Mature ID |
hsa-miR-34a-5p |
miRNA Info
|
| miRNA Mature AC |
|
| Sequence |
uggcagugucuuagcugguugu
|
| miRNA Species |
Homo sapiens |
| Regulation Mechanism |
CRTC1 mRNA is a direct target of miR-34a and miR-34a negatively regulates CRTC1. |
[1] |
| Evidence Score (E-score) |
1 |
+ |
| 1 |
ELISA; Luciferase Reporter Assay; Western Blot |
[1] |
| Representative Target(s) Regulated by This miRNA |
Amphiregulin (AREG)
|
Target Info
|
|
|
Androgen receptor (AR)
|
Target Info
|
|
| References |
Top |
| REF 1 |
The transcription cofactor CRTC1 protects from aberrant hepatic lipid accumulation. Sci Rep. 2016 Nov 21;6:37280.
|
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.
