Target Regulator(s) Information (MicroRNA)

Content Navigation (  All   None )                                      
Target General Information
The microRNAs (miRNAs) Regulating This Target
References
Target General Information  Top
Target ID T20256 Target Info
Target Name HCLS1-associated protein X-1 (HAX1)
Synonyms HSP1BP-1; HS1BP1; HS1-binding protein 1; HS1-associating protein X-1; HAX-1
Target Type Literature-reported Target
Gene Name HAX1
UniProt ID
O00165
The microRNAs (miRNAs) Regulating This Target  Top
miRNA Mature ID hsa-miR-125a-5p miRNA Info
miRNA Mature AC
MIMAT0000443
Sequence ucccugagacccuuuaaccuguga
miRNA Species Homo sapiens
Regulation Mechanism miR-125a promoted the mitochondrial apoptosis in Hep-2-CSCs which were treated with cisplatin by inhibiting the expression of HAX-1. [1]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [1]
Representative Target(s) Regulated by This miRNA Apoptosis regulator BAK (BAK) Target Info
BAK_HUMAN
Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
miRNA Mature ID hsa-miR-223-3p miRNA Info
miRNA Mature AC
MIMAT0000280
Sequence ugucaguuugucaaauacccca
miRNA Species Homo sapiens
Regulation Mechanism HAX-1 is the target of miR-223. [2]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [2]
Representative Target(s) Regulated by This miRNA ATM serine/threonine kinase (ATM) Target Info
ATM_HUMAN
C-X-C motif chemokine 2 (CXCL2) Target Info
CXCL2_HUMAN
References  Top
REF 1 Inhibition of HAX-1 by miR-125a reverses cisplatin resistance in laryngeal cancer stem cells. Oncotarget. 2016 Dec 27;7(52):86446-86456.
REF 2 MicroRNA-223 Increases the Sensitivity of Triple-Negative Breast Cancer Stem Cells to TRAIL-Induced Apoptosis by Targeting HAX-1. PLoS One. 2016 Sep 12;11(9):e0162754.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.