Content Navigation
( All
None )
| Target General Information |
Top |
| Target ID |
T21669 |
Target Info
|
| Target Name |
Glutathione S-transferase P (GSTP1) |
| Synonyms |
GSTP11; GSTP1-1; GST3; GST classpi; GST class-pi; FAEES3 |
| Target Type |
Clinical trial Target |
| Gene Name |
GSTP1 |
| Biochemical Class |
Alkyl aryl transferase |
| UniProt ID |
|
| The microRNAs (miRNAs) Regulating This Target |
Top |
| miRNA Mature ID |
hsa-miR-133b |
miRNA Info
|
| miRNA Mature AC |
|
| Sequence |
uuugguccccuucaaccagcua
|
| miRNA Species |
Homo sapiens |
| Evidence Score (E-score) |
2 |
+ |
| 1 |
Dual Luciferase Reporter Assay |
[1] |
| 2 |
Luciferase Reporter Assay |
[2] |
| Representative Target(s) Regulated by This miRNA |
Apoptosis mediating surface antigen FAS (FAS)
|
Target Info
|
|
|
Apoptosis regulator Bcl-W (BCL-W)
|
Target Info
|
|
| References |
Top |
| REF 1 |
miR-133b reverses cisplatin resistance by targeting GSTP1 in cisplatin-resistant lung cancer cells. Int J Mol Med. 2018 Apr;41(4):2050-2058.
|
| REF 2 |
MicroRNA-133b targets glutathione S-transferase expression to increase ovarian cancer cell sensitivity to chemotherapy drugs. Drug Des Devel Ther. 2015 Sep 16;9:5225-35.
|
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.
