Target Regulator(s) Information (MicroRNA)

Content Navigation (  All   None )                                      
Target General Information
The microRNAs (miRNAs) Regulating This Target
References
Target General Information  Top
Target ID T21689 Target Info
Target Name Apolipoprotein E (APOE)
Synonyms ApoE; Apo-E
Target Type Clinical trial Target
Gene Name APOE
Biochemical Class Apolipoprotein
UniProt ID
P02649
The microRNAs (miRNAs) Regulating This Target  Top
miRNA Mature ID hsa-miR-1908-5p miRNA Info
miRNA Mature AC
MIMAT0007881
Sequence cggcggggacggcgauugguc
miRNA Species Homo sapiens
Regulation Mechanism ApoE 3'UTR is directly targeted by miR-1908. [1]
Evidence Score (E-score) 1 +
1 ELISA; Luciferase Reporter Assay [1]
Representative Target(s) Regulated by This miRNA Apolipoprotein E (APOE) Target Info
APOE_HUMAN
References  Top
REF 1 Convergent multi-miRNA targeting of ApoE drives LRP1/LRP8-dependent melanoma metastasis and angiogenesis. Cell. 2012 Nov 21;151(5):1068-82.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.