Content Navigation
( All
None )
| Target General Information |
Top |
| Target ID |
T23666 |
Target Info
|
| Target Name |
Aryl hydrocarbon receptor (AHR) |
| Synonyms |
bHLHe76; Class E basic helixloophelix protein 76; Class E basic helix-loop-helix protein 76; AhR; Ah receptor |
| Target Type |
Successful Target |
| Gene Name |
AHR |
| UniProt ID |
|
| The microRNAs (miRNAs) Regulating This Target |
Top |
| miRNA Mature ID |
hsa-miR-29a-3p |
miRNA Info
|
| miRNA Mature AC |
|
| Sequence |
uagcaccaucugaaaucgguua
|
| miRNA Species |
Homo sapiens |
| Regulation Mechanism |
miR-29 targets the AHR 3'UTR at a site. Inhibition of miR-29 in vivo leads to the loss of miR-29-mediated repression of AHR and thereby promotes the anti-lipogenic activity of AHR. |
[1] |
| Evidence Score (E-score) |
1 |
+ |
| 1 |
Luciferase Reporter Assay; Western Blot |
[1] |
| Representative Target(s) Regulated by This miRNA |
Apoptosis regulator Bcl-2 (BCL-2)
|
Target Info
|
|
|
Aryl hydrocarbon receptor (AHR)
|
Target Info
|
|
| References |
Top |
| REF 1 |
Inhibition of miR-29 has a significant lipid-lowering benefit through suppression of lipogenic programs in liver. Sci Rep. 2015 Aug 6;5:12911.
|
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.
