Content Navigation
( All
None )
| Target General Information |
Top |
| Target ID |
T24823 |
Target Info
|
| Target Name |
Lysine-specific histone demethylase 1B (KDM1B) |
| Synonyms |
Lysine-specific histone demethylase 2; LSD2; Flavin-containing amine oxidase domain-containing protein 1; C6orf193; AOF1 |
| Target Type |
Patented-recorded Target |
| Gene Name |
KDM1B |
| Biochemical Class |
CH-NH(2) donor oxidoreductase |
| UniProt ID |
|
| The microRNAs (miRNAs) Regulating This Target |
Top |
| miRNA Mature ID |
hsa-miR-215-5p |
miRNA Info
|
| miRNA Mature AC |
|
| Sequence |
augaccuaugaauugacagac
|
| miRNA Species |
Homo sapiens |
| Regulation Mechanism |
Luciferase expression was repressed by miR-215 in a dose-dependent manner in HEK293T cells, whereas expression of the luciferase with mutated 3'UTR was not altered significantly. |
[1] |
| Evidence Score (E-score) |
1 |
+ |
| 1 |
Luciferase Reporter Assay |
[1] |
| Representative Target(s) Regulated by This miRNA |
Activated leukocyte cell adhesionmolecule (ALCAM)
|
Target Info
|
|
|
Activin receptor type IIB (ACVR2B)
|
Target Info
|
|
| References |
Top |
| REF 1 |
MiR-215 Is Induced Post-transcriptionally via HIF-Drosha Complex and Mediates Glioma-Initiating Cell Adaptation to Hypoxia by Targeting KDM1B. Cancer Cell. 2016 Jan 11;29(1):49-60.
|
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.
