Target Regulator(s) Information (MicroRNA)

Content Navigation (  All   None )                                      
Target General Information
The microRNAs (miRNAs) Regulating This Target
References
Target General Information  Top
Target ID T25200 Target Info
Target Name Ribonuclease L (RNASEL)
Synonyms Ribonuclease 4; RNase L; RNS4; 25Adependent ribonuclease; 25Adependent RNase; 2-5A-dependent ribonuclease; 2-5A-dependent RNase
Target Type Literature-reported Target
Gene Name RNASEL
Biochemical Class Endoribonucleases
UniProt ID
Q05823
The microRNAs (miRNAs) Regulating This Target  Top
miRNA Mature ID hsa-miR-29a-3p miRNA Info
miRNA Mature AC
MIMAT0000086
Sequence uagcaccaucugaaaucgguua
miRNA Species Homo sapiens
Regulation Mechanism miR-29-mediated repression as a novel mechanism regulating RNase-L expression. [1]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [1]
Representative Target(s) Regulated by This miRNA Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
Aryl hydrocarbon receptor (AHR) Target Info
AHR_HUMAN
References  Top
REF 1 Regulation of human RNase-L by the miR-29 family reveals a novel oncogenic role in chronic myelogenous leukemia. J Interferon Cytokine Res. 2013 Jan;33(1):34-42.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.