Target Regulator(s) Information (MicroRNA)

Content Navigation (  All   None )                                      
Target General Information
The microRNAs (miRNAs) Regulating This Target
References
Target General Information  Top
Target ID T26338 Target Info
Target Name Homeobox protein Hox-A7 (HOXA7)
Synonyms HoxA7; Hox-1A; Hox 1.1; Homeobox protein Hox-1A; Homeobox protein Hox 1.1; HOX1A
Target Type Literature-reported Target
Gene Name HOXA7
Biochemical Class Antp homeobox
UniProt ID
P31268
The microRNAs (miRNAs) Regulating This Target  Top
miRNA Mature ID hsa-miR-142-3p miRNA Info
miRNA Mature AC
MIMAT0000434
Sequence uguaguguuuccuacuuuaugga
miRNA Species Homo sapiens
Regulation Mechanism Exogenous expression of miR-142-3p strongly reduced the expression of MLL-AF4 target gene HOXA7. [1]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay [1]
Representative Target(s) Regulated by This miRNA ATP-binding cassette transporter G2 (ABCG2) Target Info
ABCG2_HUMAN
High mobility group protein B1 (HMGB1) Target Info
HMGB1_HUMAN
miRNA Mature ID hsa-miR-196a-5p miRNA Info
miRNA Mature AC
MIMAT0000226
Sequence uagguaguuucauguuguuggg
miRNA Species Homo sapiens
Regulation Mechanism The overexpression of miR-196a-5p resulted in the decreased protein level of target HOXA7; The Underexpression by Anti-miRNA Oligonucleotides resulted in the unchanged mRNA level of target HOXA7. [2]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay [2]
Representative Target(s) Regulated by This miRNA Calgranulin B (S100A9) Target Info
S10A9_HUMAN
Homeobox protein Hox-A7 (HOXA7) Target Info
HXA7_HUMAN
References  Top
REF 1 MicroRNA-142-3p inhibits cell proliferation in human acute lymphoblastic leukemia by targeting the MLL-AF4 oncogene. Mol Biol Rep. 2013 Dec;40(12):6811-9.
REF 2 MicroRNA-directed cleavage of HOXB8 mRNA. Science. 2004 Apr 23;304(5670):594-6.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.