Content Navigation
( All
None )
| Target General Information |
Top |
| Target ID |
T28692 |
Target Info
|
| Target Name |
Lipoprotein lipase (LPL) |
| Synonyms |
LIPD |
| Target Type |
Successful Target |
| Gene Name |
LPL |
| Biochemical Class |
Carboxylic ester hydrolase |
| UniProt ID |
|
| The microRNAs (miRNAs) Regulating This Target |
Top |
| miRNA Mature ID |
hsa-miR-29a-3p |
miRNA Info
|
| miRNA Mature AC |
|
| Sequence |
uagcaccaucugaaaucgguua
|
| miRNA Species |
Homo sapiens |
| Regulation Mechanism |
miR-29a inhibitor 'Uediated effects on oxLDL-stimulated DCs were found to be blocked by the siRNA treatment of LPL indicating that LPL is indeed a functional target gene of miR-29a. |
[1] |
| Evidence Score (E-score) |
2 |
+ |
| 1 |
ELISA; Luciferase Reporter Assay; Western Blot |
[1] |
| 2 |
qPCR |
[2] |
| Representative Target(s) Regulated by This miRNA |
Apoptosis regulator Bcl-2 (BCL-2)
|
Target Info
|
|
|
Aryl hydrocarbon receptor (AHR)
|
Target Info
|
|
| References |
Top |
| REF 1 |
MicroRNA-29a regulates pro-inflammatory cytokine secretion and scavenger receptor expression by targeting LPL in oxLDL-stimulated dendritic cells. FEBS Lett. 2011 Feb 18;585(4):657-63.
|
| REF 2 |
A screen in mice uncovers repression of lipoprotein lipase by microRNA-29a as a mechanism for lipid distribution away from the liver. Hepatology. 2015 Jan;61(1):141-52.
|
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.
