Target Regulator(s) Information (MicroRNA)

Content Navigation (  All   None )                                      
Target General Information
The microRNAs (miRNAs) Regulating This Target
References
Target General Information  Top
Target ID T29355 Target Info
Target Name DNA [cytosine-5]-methyltransferase 3A (DNMT3A)
Synonyms M.HsaIIIA; Dnmt3a; DNA methyltransferase HsaIIIA; DNA MTase HsaIIIA; DNA (cytosine-5)-methyltransferase 3A
Target Type Patented-recorded Target
Gene Name DNMT3A
Biochemical Class Methyltransferase
UniProt ID
Q9Y6K1
The microRNAs (miRNAs) Regulating This Target  Top
miRNA Mature ID hsa-miR-29c-3p miRNA Info
miRNA Mature AC
MIMAT0000681
Sequence uagcaccauuugaaaucgguua
miRNA Species Homo sapiens
Evidence Score (E-score) 5 +
1 Immunoblot; Luciferase Reporter Assay; qRT-PCR; Western Blot [1]
2 Immunohistochemistry; Microarray; Western Blot [2]
3 Luciferase Reporter Assay; qRT-PCR; Western Blot [3]
4 Luciferase Reporter Assay; Western Blot [4]
5 Luciferase Reporter Assay; Western Blot; qRT-PCR; Reporter Assay [5]
Representative Target(s) Regulated by This miRNA Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
B7 homolog 3 (CD276) Target Info
CD276_HUMAN
miRNA Mature ID hsa-miR-29a-3p miRNA Info
miRNA Mature AC
MIMAT0000086
Sequence uagcaccaucugaaaucgguua
miRNA Species Homo sapiens
Evidence Score (E-score) 3 +
1 Immunohistochemistry; Microarray; Western Blot [2]
2 Immunohistochemistry; Microarray; Western Blot [5]
3 Microarray; qRT-PCR [6]
Representative Target(s) Regulated by This miRNA Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
Aryl hydrocarbon receptor (AHR) Target Info
AHR_HUMAN
miRNA Mature ID hsa-miR-143-3p miRNA Info
miRNA Mature AC
MIMAT0000435
Sequence ugagaugaagcacuguagcuc
miRNA Species Homo sapiens
Evidence Score (E-score) 3 +
1 Luciferase Reporter Assay; qRT-PCR; Western Blot [7]
2 Luciferase Reporter Assay; qRT-PCR; Western Blot [5]
3 qRT-PCR; Luciferase Reporter Assay; Western Blot [8]
Representative Target(s) Regulated by This miRNA Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
Connective tissue growth factor (CTGF) Target Info
CTGF_HUMAN
miRNA Mature ID hsa-miR-200c-3p miRNA Info
miRNA Mature AC
MIMAT0000617
Sequence uaauacugccggguaaugaugga
miRNA Species Homo sapiens
Regulation Mechanism Ectopic expression of miR-200a in gastric cancer cells impaired proliferation and invasion through direct targeting of DNMT3A expression indirectly via down-regulation of SP1. [10]
Evidence Score (E-score) 2 +
1 Immunohistochemistry; Luciferase Reporter Assay; qRT-PCR; Western Blot [9]
2 In Situ Hybridization; Luciferase Reporter Assay; Western Blot [10]
Representative Target(s) Regulated by This miRNA Activin receptor type IIB (ACVR2B) Target Info
AVR2B_HUMAN
Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
miRNA Mature ID hsa-miR-200b-3p miRNA Info
miRNA Mature AC
MIMAT0000318
Sequence uaauacugccugguaaugauga
miRNA Species Homo sapiens
Regulation Mechanism Ectopic expression of miR-200b in gastric cancer cells impaired proliferation and invasion through direct targeting of DNMT3A expression indirectly via down-regulation of SP1. [10]
Evidence Score (E-score) 2 +
1 In Situ Hybridization; Luciferase Reporter Assay; Western Blot [10]
2 Luciferase Reporter Assay; qRT-PCR; Western Blot [11]
Representative Target(s) Regulated by This miRNA Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
CDK inhibitor 1B p27Kip1 (CDKN1B) Target Info
CDN1B_HUMAN
miRNA Mature ID hsa-miR-29b-3p miRNA Info
miRNA Mature AC
MIMAT0000100
Sequence uagcaccauuugaaaucaguguu
miRNA Species Homo sapiens
Regulation Mechanism The overexpression of miR-29b-3p by mature miRNA precursor transfection resulted in the decreased protein level of target DNMT3A. [5]
Evidence Score (E-score) 1 +
1 Western Blot [5]
Representative Target(s) Regulated by This miRNA Beta-secretase 1 (BACE1) Target Info
BACE1_HUMAN
Cyclin-dependent kinase 6 (CDK6) Target Info
CDK6_HUMAN
miRNA Mature ID hsa-miR-29c-5p miRNA Info
miRNA Mature AC
MIMAT0004673
Sequence ugaccgauuucuccugguguuc
miRNA Species Homo sapiens
Regulation Mechanism DNA methyltransferase 3a are the target gene of miR-29c. [12]
Evidence Score (E-score) 1 +
1 Immunohistochemistry; Western Blot [12]
Representative Target(s) Regulated by This miRNA DNA [cytosine-5]-methyltransferase 3A (DNMT3A) Target Info
DNM3A_HUMAN
DNA [cytosine-5]-methyltransferase 3B (DNMT3B) Target Info
DNM3B_HUMAN
miRNA Mature ID hsa-miR-369-5p miRNA Info
miRNA Mature AC
MIMAT0001621
Sequence agaucgaccguguuauauucgc
miRNA Species Homo sapiens
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay [13]
Representative Target(s) Regulated by This miRNA DNA [cytosine-5]-methyltransferase 3A (DNMT3A) Target Info
DNM3A_HUMAN
DNA [cytosine-5]-methyltransferase 3B (DNMT3B) Target Info
DNM3B_HUMAN
References  Top
REF 1 Mechanisms underlying aberrant expression of miR-29c in uterine leiomyoma. Fertil Steril. 2016 Jan;105(1):236-45.e1.
REF 2 microRNAome changes in bystander three-dimensional human tissue models suggest priming of apoptotic pathways. Carcinogenesis. 2010 Oct;31(10):1882-8.
REF 3 Deregulation between miR-29b/c and DNMT3A is associated with epigenetic silencing of the CDH1 gene, affecting cell migration and invasion in gastric cancer. PLoS One. 2015 Apr 15;10(4):e0123926.
REF 4 MicroRNA miR-29c down-regulation leading to de-repression of its target DNA methyltransferase 3a promotes ischemic brain damage. PLoS One. 2013;8(3):e58039.
REF 5 MicroRNA-29 family reverts aberrant methylation in lung cancer by targeting DNA methyltransferases 3A and 3B. Proc Natl Acad Sci U S A. 2007 Oct 2;104(40):15805-10.
REF 6 Potential roles of microRNA-29a in the molecular pathophysiology of T-cell acute lymphoblastic leukemia. Cancer Sci. 2015 Oct;106(10):1264-77.
REF 7 MicroRNA-143 is downregulated in breast cancer and regulates DNA methyltransferases 3A in breast cancer cells. Tumour Biol. 2014 Mar;35(3):2591-8.
REF 8 MicroRNA-143 targets DNA methyltransferases 3A in colorectal cancer. Br J Cancer. 2009 Aug 18;101(4):699-706.
REF 9 Epigenetically deregulated miR-200c is involved in a negative feedback loop with DNMT3a in gastric cancer cells. Oncol Rep. 2016 Oct;36(4):2108-16.
REF 10 miR-200b and miR-200c as prognostic factors and mediators of gastric cancer cell progression. Clin Cancer Res. 2013 Oct 15;19(20):5602-12.
REF 11 Effect of the interaction between MiR-200b-3p and DNMT3A on cartilage cells of osteoarthritis patients. J Cell Mol Med. 2017 Oct;21(10):2308-2316.
REF 12 MiR-29c regulates the expression of miR-34c and miR-449a by targeting DNA methyltransferase 3a and 3b in nasopharyngeal carcinoma. BMC Cancer. 2016 Mar 15;16:218.
REF 13 Adipogenic differentiation of human mesenchymal stromal cells is down-regulated by microRNA-369-5p and up-regulated by microRNA-371. J Cell Physiol. 2011 Sep;226(9):2226-34.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.