Target Regulator(s) Information (MicroRNA)

Content Navigation (  All   None )                                      
Target General Information
The microRNAs (miRNAs) Regulating This Target
References
Target General Information  Top
Target ID T29630 Target Info
Target Name Runt-related transcription factor 3 (RUNX3)
Synonyms SL3/AKV core-binding factor alpha C subunit; SL3-3 enhancer factor 1 alpha C subunit; Polyomavirus enhancer-binding protein 2 alpha C subunit; PEBP2A3; PEBP2-alpha C; PEA2-alpha C; Oncogene AML-2; Core-binding factor subunit alpha-3; CBFA3; CBF-alpha-3; Acute myeloid leukemia 2 protein; AML2
Target Type Literature-reported Target
Gene Name RUNX3
UniProt ID
Q13761
The microRNAs (miRNAs) Regulating This Target  Top
miRNA Mature ID hsa-miR-130a-3p miRNA Info
miRNA Mature AC
MIMAT0000425
Sequence cagugcaauguuaaaagggcau
miRNA Species Homo sapiens
Regulation Mechanism miR-130a inhibits RUNX3 and activates Wnt signaling. [3]
Evidence Score (E-score) 3 +
1 Luciferase Reporter Assay [1]
2 Luciferase Reporter Assay; qRT-PCR; Western Blot [2]
3 Luciferase Reporter Assay; Western Blot [3]
Representative Target(s) Regulated by This miRNA Activin receptor-like kinase 2 (ALK-2) Target Info
ACVR1_HUMAN
Amyloid beta A4 protein (APP) Target Info
A4_HUMAN
miRNA Mature ID hsa-miR-106a-5p miRNA Info
miRNA Mature AC
MIMAT0000103
Sequence aaaagugcuuacagugcagguag
miRNA Species Homo sapiens
Evidence Score (E-score) 2 +
1 Luciferase Reporter Assay; qRT-PCR; Western Blot [4]
2 PAR-CLIP [5]
Representative Target(s) Regulated by This miRNA Amyloid beta A4 protein (APP) Target Info
A4_HUMAN
Apoptosis mediating surface antigen FAS (FAS) Target Info
TNR6_HUMAN
miRNA Mature ID hsa-miR-20a-5p miRNA Info
miRNA Mature AC
MIMAT0000075
Sequence uaaagugcuuauagugcagguag
miRNA Species Homo sapiens
Evidence Score (E-score) 2 +
1 Immunohistochemistry; Luciferase Reporter Assay; qRT-PCR; Western Blot [6]
2 PAR-CLIP [5]
Representative Target(s) Regulated by This miRNA Amyloid beta A4 protein (APP) Target Info
A4_HUMAN
Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
miRNA Mature ID hsa-miR-532-5p miRNA Info
miRNA Mature AC
MIMAT0002888
Sequence caugccuugaguguaggaccgu
miRNA Species Homo sapiens
Regulation Mechanism The downregulation of miR-532-5p by Anti-miRNA Oligonucleotide resulted in the changed protein level of target RUNX3. [8]
Evidence Score (E-score) 2 +
1 Luciferase Reporter Assay; qRT-PCR; Western Blot [7]
2 qRT-PCR; Western Blot [8]
Representative Target(s) Regulated by This miRNA C-X-C motif chemokine 2 (CXCL2) Target Info
CXCL2_HUMAN
Fatty acid synthase (FASN) Target Info
FAS_HUMAN
miRNA Mature ID hsa-miR-106b-5p miRNA Info
miRNA Mature AC
MIMAT0000680
Sequence uaaagugcugacagugcagau
miRNA Species Homo sapiens
Regulation Mechanism The downregulation of RUNX3 is mediated by miR- 106b through binding of its 30UTR. [9]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [9]
Representative Target(s) Regulated by This miRNA Amyloid beta A4 protein (APP) Target Info
A4_HUMAN
Apoptosis mediating surface antigen FAS (FAS) Target Info
TNR6_HUMAN
miRNA Mature ID hsa-miR-130b-3p miRNA Info
miRNA Mature AC
MIMAT0000691
Sequence cagugcaaugaugaaagggcau
miRNA Species Homo sapiens
Regulation Mechanism Overexpression of miR-130b downregulates RUNX3 protein in gastric cancer cell lines. [10]
Evidence Score (E-score) 1 +
1 qRT-PCR; Western Blot [10]
Representative Target(s) Regulated by This miRNA Acyl-CoA desaturase (SCD) Target Info
ACOD_HUMAN
Cyclin A2 (CCNA2) Target Info
CCNA2_HUMAN
miRNA Mature ID hsa-miR-148a-3p miRNA Info
miRNA Mature AC
MIMAT0000243
Sequence ucagugcacuacagaacuuugu
miRNA Species Homo sapiens
Regulation Mechanism miR-148a may regulate RUNX3 expression through modulation of DNMT1 dependent DNA methylation in gastric cancer and highlight a miRNA-epigenetics regulation mechanism of gene expression. [11]
Evidence Score (E-score) 1 +
1 qRT-PCR; Western Blot [11]
Representative Target(s) Regulated by This miRNA Activated leukocyte cell adhesionmolecule (ALCAM) Target Info
CD166_HUMAN
Activin receptor-like kinase 2 (ALK-2) Target Info
ACVR1_HUMAN
miRNA Mature ID hsa-miR-495-3p miRNA Info
miRNA Mature AC
MIMAT0002817
Sequence aaacaaacauggugcacuucuu
miRNA Species Homo sapiens
Regulation Mechanism Targeting of RUNX3 by miR-495 increases cell proliferation and tumor angiogenesis in gastric cancer cells. [12]
Evidence Score (E-score) 1 +
1 LacZ Reporter Assay; Microarray; Western Blot; Luciferase Reporter Assay [12]
Representative Target(s) Regulated by This miRNA Endoplasmic reticulum chaperone BiP (HSPA5) Target Info
BIP_HUMAN
Forkhead box protein C1 (FOXC1) Target Info
FOXC1_HUMAN
miRNA Mature ID hsa-miR-301a-3p miRNA Info
miRNA Mature AC
MIMAT0000688
Sequence cagugcaauaguauugucaaagc
miRNA Species Homo sapiens
Regulation Mechanism RUNX3 is at the target gene of miR-301a that directly inhibits the expression of RUNX3 through its 3'UTR. [13]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [13]
Representative Target(s) Regulated by This miRNA Apoptosis signal-regulating kinase 1 (MAP3K5) Target Info
M3K5_HUMAN
Endothelial plasminogen activator inhibitor (SERPINE1) Target Info
PAI1_HUMAN
miRNA Mature ID hsa-miR-4295 miRNA Info
miRNA Mature AC
MIMAT0016844
Sequence cagugcaauguuuuccuu
miRNA Species Homo sapiens
Regulation Mechanism miR-4295 recognizes and regulates RUNX mRNA through specific binding to its 3'UTR. [14]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [14]
Representative Target(s) Regulated by This miRNA Melanoma differentiation-associated protein 6 (CDKN1A) Target Info
CDN1A_HUMAN
Runt-related transcription factor 3 (RUNX3) Target Info
RUNX3_HUMAN
References  Top
REF 1 Downregulation of microRNA-130a contributes to endothelial progenitor cell dysfunction in diabetic patients via its target Runx3. PLoS One. 2013 Jul 12;8(7):e68611.
REF 2 miR-130a acts as a potential diagnostic biomarker and promotes gastric cancer migration, invasion and proliferation by targeting RUNX3. Oncol Rep. 2015 Sep;34(3):1153-61.
REF 3 Upregulated miR-130a increases drug resistance by regulating RUNX3 and Wnt signaling in cisplatin-treated HCC cell. Biochem Biophys Res Commun. 2012 Aug 24;425(2):468-72.
REF 4 MicroRNA-106a induces multidrug resistance in gastric cancer by targeting RUNX3. FEBS Lett. 2013 Sep 17;587(18):3069-75.
REF 5 Transcriptome-wide identification of RNA-binding protein and microRNA target sites by PAR-CLIP. Cell. 2010 Apr 2;141(1):129-41.
REF 6 MicroRNA-20a-5p targets RUNX3 to regulate proliferation and migration of human hepatocellular cancer cells. Oncol Rep. 2016 Dec;36(6):3379-3386.
REF 7 miRNA-532-5p functions as an oncogenic microRNA in human gastric cancer by directly targeting RUNX3. J Cell Mol Med. 2016 Jan;20(1):95-103.
REF 8 Regulation of RUNX3 tumor suppressor gene expression in cutaneous melanoma. Clin Cancer Res. 2009 May 1;15(9):2988-94.
REF 9 MicroRNA-106b regulates the tumor suppressor RUNX3 in laryngeal carcinoma cells. FEBS Lett. 2013 Oct 1;587(19):3166-74.
REF 10 MicroRNA-130b regulates the tumour suppressor RUNX3 in gastric cancer. Eur J Cancer. 2010 May;46(8):1456-63.
REF 11 MicroRNA-148a can regulate runt-related transcription factor 3 gene expression via modulation of DNA methyltransferase 1 in gastric cancer. Mol Cells. 2013 Apr;35(4):313-9.
REF 12 Targeting of RUNX3 by miR-130a and miR-495 cooperatively increases cell proliferation and tumor angiogenesis in gastric cancer cells. Oncotarget. 2015 Oct 20;6(32):33269-78.
REF 13 Overexpressed miR-301a promotes cell proliferation and invasion by targeting RUNX3 in gastric cancer. J Gastroenterol. 2013 Sep;48(9):1023-33.
REF 14 RUNX3 is down-regulated in glioma by Myc-regulated miR-4295. J Cell Mol Med. 2016 Mar;20(3):518-25.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.