Target Regulator(s) Information (MicroRNA)

Content Navigation (  All   None )                                      
Target General Information
The microRNAs (miRNAs) Regulating This Target
References
Target General Information  Top
Target ID T30803 Target Info
Target Name Glutathione reductase (GR)
Synonyms Glutathione reductase, mitochondrial; GRase; GRD1; GLUR
Target Type Patented-recorded Target
Gene Name GSR
Biochemical Class Sulfur donor oxidoreductase
UniProt ID
P00390
The microRNAs (miRNAs) Regulating This Target  Top
miRNA Mature ID hsa-miR-214-3p miRNA Info
miRNA Mature AC
MIMAT0000271
Sequence acagcaggcacagacaggcagu
miRNA Species Homo sapiens
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay [1]
Representative Target(s) Regulated by This miRNA Activating transcription factor 4 (ATF-4) Target Info
ATF4_HUMAN
ADP-ribosylation factor-like protein 2 (ARL2) Target Info
ARL2_HUMAN
References  Top
REF 1 MiR-214 promotes the alcohol-induced oxidative stress via down-regulation of glutathione reductase and cytochrome P450 oxidoreductase in liver cells. Alcohol Clin Exp Res. 2014 Jan;38(1):68-77.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.