Target Regulator(s) Information (MicroRNA)

Content Navigation (  All   None )                                      
Target General Information
The microRNAs (miRNAs) Regulating This Target
References
Target General Information  Top
Target ID T33455 Target Info
Target Name Insulin-like growth factor-binding protein 3 (IGFBP3)
Synonyms IGFBP-3; IGF-binding protein 3; IBP3; IBP-3
Target Type Clinical trial Target
Gene Name IGFBP3
Biochemical Class Insulin-like growth factor binding
UniProt ID
P17936
The microRNAs (miRNAs) Regulating This Target  Top
miRNA Mature ID hsa-miR-17-5p miRNA Info
miRNA Mature AC
MIMAT0000070
Sequence caaagugcuuacagugcagguag
miRNA Species Homo sapiens
Regulation Mechanism miR-17-5p directly targets and downregulates IGFBP3. [1]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay [1]
Representative Target(s) Regulated by This miRNA Amyloid beta A4 protein (APP) Target Info
A4_HUMAN
Apoptosis mediating surface antigen FAS (FAS) Target Info
TNR6_HUMAN
miRNA Mature ID hsa-miR-210-3p miRNA Info
miRNA Mature AC
MIMAT0000267
Sequence cugugcgugugacagcggcuga
miRNA Species Homo sapiens
Regulation Mechanism IGFBP3 is identified initially as miR-210 targets. [2]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [2]
Representative Target(s) Regulated by This miRNA Activin receptor type IB (ACVR1B) Target Info
ACV1B_HUMAN
Autophagy-related protein 7 (ATG7) Target Info
ATG7_HUMAN
References  Top
REF 1 Interplay between microRNA-17-5p, insulin-like growth factor-II through binding protein-3 in hepatocellular carcinoma. World J Hepatol. 2016 Aug 18;8(23):976-84.
REF 2 Seed-Milarity confers to hsa-miR-210 and hsa-miR-147b similar functional activity. PLoS One. 2012;7(9):e44919.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.