Target Regulator(s) Information (MicroRNA)

Content Navigation (  All   None )                                      
Target General Information
The microRNAs (miRNAs) Regulating This Target
References
Target General Information  Top
Target ID T33990 Target Info
Target Name Macrophage colony-stimulating factor 1 (CSF1)
Synonyms Processed macrophagecolony-stimulating factor 1; MCSF; M-CSF; Lanimostim; CSF-1
Target Type Clinical trial Target
Gene Name CSF1
UniProt ID
P09603
The microRNAs (miRNAs) Regulating This Target  Top
miRNA Mature ID hsa-miR-130a-3p miRNA Info
miRNA Mature AC
MIMAT0000425
Sequence cagugcaauguuaaaagggcau
miRNA Species Homo sapiens
Evidence Score (E-score) 2 +
1 Luciferase Reporter Assay [1]
2 Luciferase Reporter Assay; Western Blot [2]
Representative Target(s) Regulated by This miRNA Activin receptor-like kinase 2 (ALK-2) Target Info
ACVR1_HUMAN
Amyloid beta A4 protein (APP) Target Info
A4_HUMAN
miRNA Mature ID hsa-miR-148b-3p miRNA Info
miRNA Mature AC
MIMAT0000759
Sequence ucagugcaucacagaacuuugu
miRNA Species Homo sapiens
Regulation Mechanism miR-148b is a major coordinator of breast cancer progression in a relapse-associated microRNA signature by targeting CSF1. [3]
Evidence Score (E-score) 2 +
1 Luciferase Reporter Assay [3]
2 Western Blot [4]
Representative Target(s) Regulated by This miRNA Activated leukocyte cell adhesionmolecule (ALCAM) Target Info
CD166_HUMAN
Activin receptor-like kinase 2 (ALK-2) Target Info
ACVR1_HUMAN
miRNA Mature ID hsa-miR-130b-3p miRNA Info
miRNA Mature AC
MIMAT0000691
Sequence cagugcaaugaugaaagggcau
miRNA Species Homo sapiens
Regulation Mechanism CSF-1 is a direct target of miR-130b. [5]
Evidence Score (E-score) 1 +
1 ELISA; Luciferase Reporter Assay [5]
Representative Target(s) Regulated by This miRNA Acyl-CoA desaturase (SCD) Target Info
ACOD_HUMAN
Cyclin A2 (CCNA2) Target Info
CCNA2_HUMAN
miRNA Mature ID hsa-miR-152-3p miRNA Info
miRNA Mature AC
MIMAT0000438
Sequence ucagugcaugacagaacuugg
miRNA Species Homo sapiens
Regulation Mechanism CSF-1 mRNA 3'UTR is a direct target for miR-152 in ovarian cancer cells. [6]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay [6]
Representative Target(s) Regulated by This miRNA Activated leukocyte cell adhesionmolecule (ALCAM) Target Info
CD166_HUMAN
Dickkopf-related protein 1 (DKK1) Target Info
DKK1_HUMAN
miRNA Mature ID hsa-miR-1207-5p miRNA Info
miRNA Mature AC
MIMAT0005871
Sequence uggcagggaggcugggagggg
miRNA Species Homo sapiens
Regulation Mechanism miR-1207-5p targets CSF1, an essential growth factor for macrophage, and thus modulate the tumor microenvironment. [7]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay [7]
Representative Target(s) Regulated by This miRNA Macrophage colony-stimulating factor 1 (CSF1) Target Info
CSF1_HUMAN
Signal transducer and activator of transcription 6 (STAT6) Target Info
STAT6_HUMAN
References  Top
REF 1 Prediction of mammalian microRNA targets. Cell. 2003 Dec 26;115(7):787-98.
REF 2 Role of microRNAs in drug-resistant ovarian cancer cells. Gynecol Oncol. 2008 Dec;111(3):478-86.
REF 3 miR148b is a major coordinator of breast cancer progression in a relapse-associated microRNA signature by targeting ITGA5, ROCK1, PIK3CA, NRAS, and CSF1. FASEB J. 2013 Mar;27(3):1223-35.
REF 4 Down-regulation of miR-21 biogenesis by estrogen action contributes to osteoclastic apoptosis. J Cell Biochem. 2013 Jun;114(6):1217-22.
REF 5 Epigenetic silencing of miR-130b in ovarian cancer promotes the development of multidrug resistance by targeting colony-stimulating factor 1. Gynecol Oncol. 2012 Feb;124(2):325-34.
REF 6 Regulation of colony stimulating factor-1 expression and ovarian cancer cell behavior in vitro by miR-128 and miR-152. Mol Cancer. 2012 Aug 21;11:58.
REF 7 miR-1207-5p suppresses lung cancer growth and metastasis by targeting CSF1. Oncotarget. 2016 May 31;7(22):32421-32.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.