Target Regulator(s) Information (MicroRNA)

Content Navigation (  All   None )                                      
Target General Information
The microRNAs (miRNAs) Regulating This Target
References
Target General Information  Top
Target ID T37434 Target Info
Target Name Prominin-1 (PROM1)
Synonyms Promininlike protein 1; Prominin1; Prominin-like protein 1; PROML1; MSTP061; CD133; Antigen AC133
Target Type Clinical trial Target
Gene Name PROM1
UniProt ID
O43490
The microRNAs (miRNAs) Regulating This Target  Top
miRNA Mature ID hsa-miR-142-3p miRNA Info
miRNA Mature AC
MIMAT0000434
Sequence uguaguguuuccuacuuuaugga
miRNA Species Homo sapiens
Evidence Score (E-score) 2 +
1 Luciferase Reporter Assay; Western Blot [1]
2 Reporter Assay [2]
Representative Target(s) Regulated by This miRNA ATP-binding cassette transporter G2 (ABCG2) Target Info
ABCG2_HUMAN
High mobility group protein B1 (HMGB1) Target Info
HMGB1_HUMAN
miRNA Mature ID hsa-miR-200b-5p miRNA Info
miRNA Mature AC
MIMAT0004571
Sequence caucuuacugggcagcauugga
miRNA Species Homo sapiens
Regulation Mechanism Luciferase activity of U251 cells was decreased with a significant difference after co-transfection of the 3'UTR of CD133 and miRNA-200b mimic. [3]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay [3]
Representative Target(s) Regulated by This miRNA Prominin-1 (PROM1) Target Info
PROM1_HUMAN
Transforming protein RhoA (RHOA) Target Info
RHOA_HUMAN
miRNA Mature ID hsa-miR-487b-5p miRNA Info
miRNA Mature AC
MIMAT0026614
Sequence gugguuaucccuguccuguucg
miRNA Species Homo sapiens
Regulation Mechanism Overexpression of miR-487b in a pediatric glioma cell line (KNS42) using lentiviral vectors led to a decrease in colony formation in soft agar, and decreased expression of known predicted targets PROM1. [4]
Evidence Score (E-score) 1 +
1 qRT-PCR [4]
Representative Target(s) Regulated by This miRNA Nestin (NES) Target Info
NEST_HUMAN
Prominin-1 (PROM1) Target Info
PROM1_HUMAN
References  Top
REF 1 MiR-142-3p functions as a tumor suppressor by targeting CD133, ABCG2, and Lgr5 in colon cancer cells. J Mol Med (Berl). 2013 Aug;91(8):989-1000.
REF 2 Combined characterization of microRNA and mRNA profiles delineates early differentiation pathways of CD133+ and CD34+ hematopoietic stem and progenitor cells. Stem Cells. 2011 May;29(5):847-57.
REF 3 Targeting effect of microRNA on CD133 and its impact analysis on proliferation and invasion of glioma cells. Genet Mol Res. 2017 Mar 30;16(1).
REF 4 MicroRNA profiling of low-grade glial and glioneuronal tumors shows an independent role for cluster 14q32.31 member miR-487b. Mod Pathol. 2017 Feb;30(2):204-216.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.