Target Regulator(s) Information (MicroRNA)

Content Navigation (  All   None )                                      
Target General Information
The microRNAs (miRNAs) Regulating This Target
References
Target General Information  Top
Target ID T38431 Target Info
Target Name Calgranulin B (S100A9)
Synonyms S100 calcium-binding protein A9; Protein S100-A9; P14; Myeloid-related protein 14; Migration inhibitory factor-related protein 14; MRP14; MRP-14; Leukocyte L1 complex heavy chain; Calprotectin L1H subunit; Calgranulin-B; CAGB
Target Type Clinical trial Target
Gene Name S100A9
Biochemical Class S100 calcium-binding protein
UniProt ID
P06702
The microRNAs (miRNAs) Regulating This Target  Top
miRNA Mature ID hsa-miR-196a-5p miRNA Info
miRNA Mature AC
MIMAT0000226
Sequence uagguaguuucauguuguuggg
miRNA Species Homo sapiens
Regulation Mechanism The overexpression of miR-196a-5p by mature miRNA mimics tranfection resulted in the changed mRNA level of target S100A9. [1]
Evidence Score (E-score) 1 +
1 qRT-PCR; Luciferase Reporter Assay [1]
Representative Target(s) Regulated by This miRNA Calgranulin B (S100A9) Target Info
S10A9_HUMAN
Homeobox protein Hox-A7 (HOXA7) Target Info
HXA7_HUMAN
References  Top
REF 1 MicroRNA-196a is a potential marker of progression during Barrett's metaplasia-dysplasia-invasive adenocarcinoma sequence in esophagus. Am J Pathol. 2009 May;174(5):1940-8.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.