Target Regulator(s) Information (MicroRNA)
| Target General Information | Top | ||||
|---|---|---|---|---|---|
| Target ID | T39977 | Target Info | |||
| Target Name | Macrophage migration inhibitory factor (MIF) | ||||
| Synonyms | Phenylpyruvate tautomerase; MMIF; L-dopachrome tautomerase; L-dopachrome isomerase; Glycosylation-inhibiting factor; GLIF; GIF | ||||
| Target Type | Clinical trial Target | ||||
| Gene Name | MIF | ||||
| Biochemical Class | Intramolecular oxidoreductase | ||||
| UniProt ID | |||||
| The microRNAs (miRNAs) Regulating This Target | Top | ||||
|---|---|---|---|---|---|
| miRNA Mature ID | hsa-miR-451a | miRNA Info | |||
| miRNA Mature AC | |||||
| Sequence | aaaccguuaccauuacugaguu | ||||
| miRNA Species | Homo sapiens | ||||
| Regulation Mechanism | The overexpression of miR-451a by mature miRNA precursor transfection resulted in the decreased protein level of target MIF. | [3] | |||
| Evidence Score (E-score) | 4 | + | |||
| 1 | Luciferase Reporter Assay | [1] | |||
| 2 | Luciferase Reporter Assay | [2] | |||
| 3 | Luciferase Reporter Assay | [3] | |||
| 4 | Luciferase Reporter Assay; Western Blot | [4] | |||
| Representative Target(s) Regulated by This miRNA | Apoptosis regulator Bcl-2 (BCL-2) | Target Info | |||
| Extracellular signal-regulated kinase 2 (ERK2) | Target Info | ||||
| miRNA Mature ID | hsa-miR-146a-5p | miRNA Info | |||
| miRNA Mature AC | |||||
| Sequence | ugagaacugaauuccauggguu | ||||
| miRNA Species | Homo sapiens | ||||
| Regulation Mechanism | Transfection with miR-146a mimics resulted in the decreased bith protein and mRNA of MIF. | [5] | |||
| Evidence Score (E-score) | 1 | + | |||
| 1 | Luciferase Reporter Assay; Western Blot | [5] | |||
| Representative Target(s) Regulated by This miRNA | Activation B7-1 antigen (CD80) | Target Info | |||
| Apoptosis mediating surface antigen FAS (FAS) | Target Info | ||||
| miRNA Mature ID | hsa-miR-1228-5p | miRNA Info | |||
| miRNA Mature AC | |||||
| Sequence | gugggcgggggcaggugugug | ||||
| miRNA Species | Homo sapiens | ||||
| Regulation Mechanism | miR-1228 acts as a negative regulator of gastric cancer growth and angiogenesis through downregulation of MIF. | [6] | |||
| Evidence Score (E-score) | 1 | + | |||
| 1 | ELISA; Luciferase Reporter Assay; Western Blot | [6] | |||
| Representative Target(s) Regulated by This miRNA | Macrophage migration inhibitory factor (MIF) | Target Info | |||
| References | Top | ||||
|---|---|---|---|---|---|
| REF 1 | MiR-451 suppresses proliferation, migration and promotes apoptosis of the human osteosarcoma by targeting macrophage migration inhibitory factor. Biomed Pharmacother. 2017 Mar;87:621-627. | ||||
| REF 2 | microRNA-451 inhibited cell proliferation, migration and invasion through regulation of MIF in renal cell carcinoma. Int J Clin Exp Pathol. 2015 Dec 1;8(12):15611-21. | ||||
| REF 3 | microRNA-451 regulates macrophage migration inhibitory factor production and proliferation of gastrointestinal cancer cells. Clin Cancer Res. 2009 Apr 1;15(7):2281-90. | ||||
| REF 4 | MiR-451 inhibits cell growth and invasion by targeting MIF and is associated with survival in nasopharyngeal carcinoma. Mol Cancer. 2013 Oct 20;12(1):123. | ||||
| REF 5 | Effect and molecular mechanism of mir-146a on proliferation of lung cancer cells by targeting and regulating MIF gene. Asian Pac J Trop Med. 2016 Aug;9(8):806-11. | ||||
| REF 6 | microRNA-1228 /sup> impairs the pro-angiogenic activity of gastric cancer cells by targeting macrophage migration inhibitory factor. Life Sci. 2017 Jul 1;180:9-16. | ||||
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.