Target Regulator(s) Information (MicroRNA)

Content Navigation (  All   None )                                      
Target General Information
The microRNAs (miRNAs) Regulating This Target
References
Target General Information  Top
Target ID T42392 Target Info
Target Name Glutamate receptor AMPA 2 (GRIA2)
Synonyms Glutamate receptor ionotropic, AMPA 2; Glutamate receptor 2; GluRK2; GluRB; GluR2; GluR-K2; GluR-B; GluR-2; GluA2; AMPAselective glutamate receptor 2; AMPA-selective glutamate receptor 2
Target Type Successful Target
Gene Name GRIA2
Biochemical Class Glutamate-gated ion channel
UniProt ID
P42262
The microRNAs (miRNAs) Regulating This Target  Top
miRNA Mature ID hsa-miR-181b-5p miRNA Info
miRNA Mature AC
MIMAT0000257
Sequence aacauucauugcugucggugggu
miRNA Species Homo sapiens
Regulation Mechanism The overexpression of miR-181b-5p by siRNA transfection resulted in the changed mRNA level of target GRIA2. [1]
Evidence Score (E-score) 1 +
1 qRT-PCR; Luciferase Reporter Assay [1]
Representative Target(s) Regulated by This miRNA Estrogen receptor (ESR) Target Info
ESR1_HUMAN
Glutamate receptor AMPA 2 (GRIA2) Target Info
GRIA2_HUMAN
References  Top
REF 1 Dysregulation of miRNA 181b in the temporal cortex in schizophrenia. Hum Mol Genet. 2008 Apr 15;17(8):1156-68.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.