Content Navigation
( All
None )
| Target General Information |
Top |
| Target ID |
T44190 |
Target Info
|
| Target Name |
TIR domain-containing adapter molecule 1 (TICAM1) |
| Synonyms |
Toll-interleukin-1 receptor domain-containing adapter protein inducing interferon beta; TRIF; TIR domain-containing adapter protein inducing IFN-beta; TICAM-1; Putative NF-kappa-B-activating protein 502H; Proline-rich, vinculin and TIR domain-containing protein B; PRVTIRB; MyD88-3 |
| Target Type |
Patented-recorded Target |
| Gene Name |
TICAM1 |
| UniProt ID |
|
| The microRNAs (miRNAs) Regulating This Target |
Top |
| miRNA Mature ID |
hsa-miR-221-3p |
miRNA Info
|
| miRNA Mature AC |
|
| Sequence |
agcuacauugucugcuggguuuc
|
| miRNA Species |
Homo sapiens |
| Regulation Mechanism |
miR-221-mediated translational suppression controls ICAM-1 expression in epithelial cells in response to Cryptosporidium Parvum infection. |
[1] |
| Evidence Score (E-score) |
2 |
+ |
| 1 |
Luciferase Reporter Assay; Northern Blot; Western Blot |
[1] |
| 2 |
Reporter Assay; Western Blot |
[2] |
| Representative Target(s) Regulated by This miRNA |
Bcl-2-binding component 3 (BBC3)
|
Target Info
|
|
|
Beclin-1 (BECN1)
|
Target Info
|
|
| References |
Top |
| REF 1 |
MicroRNA-221 controls expression of intercellular adhesion molecule-1 in epithelial cells in response to Cryptosporidium parvum infection. Int J Parasitol. 2011 Mar;41(3-4):397-403.
|
| REF 2 |
Clustered microRNAs hsa-miR-221-3p/hsa-miR-222-3p and their targeted genes might be prognostic predictors for hepatocellular carcinoma. J Cancer. 2019 Jun 2;10(11):2520-2533.
|
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.
