Target Regulator(s) Information (MicroRNA)

Content Navigation (  All   None )                                      
Target General Information
The microRNAs (miRNAs) Regulating This Target
References
Target General Information  Top
Target ID T45758 Target Info
Target Name CD40L receptor (CD40)
Synonyms Tumor necrosis factor receptor superfamily member 5; TNFRSF5; CDw40; Bp50; B-cell surfaceantigen CD40; B-cell surface antigen CD40
Target Type Clinical trial Target
Gene Name CD40
Biochemical Class Cytokine receptor
UniProt ID
P25942
The microRNAs (miRNAs) Regulating This Target  Top
miRNA Mature ID hsa-miR-224-5p miRNA Info
miRNA Mature AC
MIMAT0000281
Sequence ucaagucacuagugguuccguuuag
miRNA Species Homo sapiens
Regulation Mechanism A significant overexpression of CD40-related miRNAs miR-224 was detected in highly invasive and metastatic PDAC and CD40 protein expression at cell surfaces of these highly invasive and metastatic PDAC was significantly reduced. [2]
Evidence Score (E-score) 2 +
1 Luciferase Reporter Assay [1]
2 Microarray [2]
Representative Target(s) Regulated by This miRNA APJ endogenous ligand (Apelin) Target Info
APEL_HUMAN
Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
miRNA Mature ID hsa-miR-145-5p miRNA Info
miRNA Mature AC
MIMAT0000437
Sequence guccaguuuucccaggaaucccu
miRNA Species Homo sapiens
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay [3]
Representative Target(s) Regulated by This miRNA A proliferation-inducing ligand (APRIL) Target Info
TNF13_HUMAN
Alkaline phosphatase (ALPPL2) Target Info
PPBN_HUMAN
miRNA Mature ID hsa-miR-503-5p miRNA Info
miRNA Mature AC
MIMAT0002874
Sequence uagcagcgggaacaguucugcag
miRNA Species Homo sapiens
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay [4]
Representative Target(s) Regulated by This miRNA Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
CD40L receptor (CD40) Target Info
TNR5_HUMAN
References  Top
REF 1 MiR-145-5p regulates hypoxia-induced inflammatory response and apoptosis in cardiomyocytes by targeting CD40. Mol Cell Biochem. 2017 Jul;431(1-2):123-131.
REF 2 Involvement of CD40 targeting miR-224 and miR-486 on the progression of pancreatic ductal adenocarcinomas. Ann Surg Oncol. 2009 Aug;16(8):2339-50.
REF 3 miRNA-145 inhibits VSMC proliferation by targeting CD40. Sci Rep. 2016 Oct 12;6:35302.
REF 4 Investigation of the interaction between the MIR-503 and CD40 genes in irradiated U937 cells. Radiat Oncol. 2012 Mar 20;7:38.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.