Content Navigation
( All
None )
Target General Information |
Top |
Target ID |
T47885 |
Target Info
|
Target Name |
Protein kinase D (PRKD1) |
Synonyms |
nPKC-mu; nPKC-D1; Serine/threonine-protein kinase D1; Protein kinase C mu type; PRKCM; PKD1; PKD |
Target Type |
Literature-reported Target |
Gene Name |
PRKD1 |
Biochemical Class |
Kinase |
UniProt ID |
|
The microRNAs (miRNAs) Regulating This Target |
Top |
miRNA Mature ID |
hsa-miR-124-3p |
miRNA Info
|
miRNA Mature AC |
|
Sequence |
uaaggcacgcggugaaugcc
|
miRNA Species |
Homo sapiens |
Evidence Score (E-score) |
1 |
+ |
1 |
Luciferase Reporter Assay |
[1] |
Representative Target(s) Regulated by This miRNA |
Beta-secretase 1 (BACE1)
|
Target Info
|
|
Brain-derived neurotrophic factor (BDNF)
|
Target Info
|
|
miRNA Mature ID |
hsa-miR-34a-5p |
miRNA Info
|
miRNA Mature AC |
|
Sequence |
uggcagugucuuagcugguugu
|
miRNA Species |
Homo sapiens |
Regulation Mechanism |
miR-34a negatively regulates PRKD1 by binding to the PRKD1 3'UTR. |
[2] |
Evidence Score (E-score) |
1 |
+ |
1 |
Luciferase Reporter Assay; Western Blot |
[2] |
Representative Target(s) Regulated by This miRNA |
Amphiregulin (AREG)
|
Target Info
|
|
Androgen receptor (AR)
|
Target Info
|
|
References |
Top |
REF 1 |
A biochemical approach to identifying microRNA targets. Proc Natl Acad Sci U S A. 2007 Dec 4;104(49):19291-6.
|
REF 2 |
A novel miR-34a target, protein kinase D1, stimulates cancer stemness and drug resistance through GSK3/-catenin signaling in breast cancer. Oncotarget. 2016 Mar 22;7(12):14791-802.
|
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.