Target Regulator(s) Information (MicroRNA)

Content Navigation (  All   None )                                      
Target General Information
The microRNAs (miRNAs) Regulating This Target
References
Target General Information  Top
Target ID T60724 Target Info
Target Name Sclerostin (SOST)
Synonyms UNQ2976/PRO7455/PRO7476
Target Type Successful Target
Gene Name SOST
UniProt ID
Q9BQB4
The microRNAs (miRNAs) Regulating This Target  Top
miRNA Mature ID hsa-miR-204-5p miRNA Info
miRNA Mature AC
MIMAT0000265
Sequence uucccuuugucauccuaugccu
miRNA Species Homo sapiens
Regulation Mechanism Sost, which Encodes a Wnt Signaling Antagonist, is a Direct Target of mir-204. [1]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay [1]
Representative Target(s) Regulated by This miRNA Alkaline phosphatase tissue-nonspecific (ALPL) Target Info
PPBT_HUMAN
Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
References  Top
REF 1 Identification and characterization of microRNAs controlled by the osteoblast-specific transcription factor Osterix. PLoS One. 2013;8(3):e58104.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.