Target Regulator(s) Information (MicroRNA)

Content Navigation (  All   None )                                      
Target General Information
The microRNAs (miRNAs) Regulating This Target
References
Target General Information  Top
Target ID T62936 Target Info
Target Name Hepatocellular carcinoma-associated protein (HCAP)
Synonyms YY1AP; YY1-associated protein 1; Hepatocellular carcinoma-associated protein 2; Hepatocellular carcinoma susceptibility protein; HCCA2; HCCA1
Target Type Literature-reported Target
Gene Name YY1AP1
UniProt ID
Q8IXA6
The microRNAs (miRNAs) Regulating This Target  Top
miRNA Mature ID hsa-miR-132-3p miRNA Info
miRNA Mature AC
MIMAT0000426
Sequence uaacagucuacagccauggucg
miRNA Species Homo sapiens
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [1]
Representative Target(s) Regulated by This miRNA Brain-derived neurotrophic factor (BDNF) Target Info
BDNF_HUMAN
Cyclin A2 (CCNA2) Target Info
CCNA2_HUMAN
References  Top
REF 1 Hsa-miR-132 inhibits proliferation of hepatic carcinoma cells by targeting YAP. Cell Biochem Funct. 2015 Jul;33(5):326-33.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.