Target Regulator(s) Information (MicroRNA)

Content Navigation (  All   None )                                      
Target General Information
The microRNAs (miRNAs) Regulating This Target
References
Target General Information  Top
Target ID T64682 Target Info
Target Name Serine/threonine-protein kinase Sgk1 (SGK1)
Synonyms Serum/glucocorticoid-regulated kinase 1; SGK1
Target Type Clinical trial Target
Gene Name SGK1
Biochemical Class Kinase
UniProt ID
O00141
The microRNAs (miRNAs) Regulating This Target  Top
miRNA Mature ID hsa-miR-133b miRNA Info
miRNA Mature AC
MIMAT0000770
Sequence uuugguccccuucaaccagcua
miRNA Species Homo sapiens
Regulation Mechanism miR-133b directly targets SGK1 to reverse the hydrosalpinx-induced down-regulation of HOXA10 and to attenuate the impairment of embryo attachment in vitro. [1]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [1]
Representative Target(s) Regulated by This miRNA Apoptosis mediating surface antigen FAS (FAS) Target Info
TNR6_HUMAN
Apoptosis regulator Bcl-W (BCL-W) Target Info
B2CL2_HUMAN
References  Top
REF 1 miR-133b Reverses the Hydrosalpinx-induced Impairment of Embryo Attachment Through Down-regulation of SGK1. J Clin Endocrinol Metab. 2016 Apr;101(4):1478-89.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.