Content Navigation
( All
None )
Target General Information |
Top |
Target ID |
T67754 |
Target Info
|
Target Name |
Transketolase (TK) |
Synonyms |
TKT1; SDDHD; HEL107; HEL-S-48 |
Target Type |
Literature-reported Target |
Gene Name |
TKT |
Biochemical Class |
Transketolase |
UniProt ID |
|
The microRNAs (miRNAs) Regulating This Target |
Top |
miRNA Mature ID |
hsa-miR-206 |
miRNA Info
|
miRNA Mature AC |
|
Sequence |
uggaauguaaggaagugugugg
|
miRNA Species |
Homo sapiens |
Regulation Mechanism |
miR-206 miRNA targets TKT in cancer cells and non-neoplastic fibroblast cells. |
[1] |
Evidence Score (E-score) |
1 |
+ |
1 |
Luciferase Reporter Assay; Western Blot |
[1] |
Representative Target(s) Regulated by This miRNA |
Annexin A2 (ANXA2)
|
Target Info
|
|
Apoptosis regulator Bcl-2 (BCL-2)
|
Target Info
|
|
References |
Top |
REF 1 |
Transcription factor NRF2 regulates miR-1 and miR-206 to drive tumorigenesis. J Clin Invest. 2013 Jul;123(7):2921-34.
|
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.