Target Regulator(s) Information (MicroRNA)

Content Navigation (  All   None )                                      
Target General Information
The microRNAs (miRNAs) Regulating This Target
References
Target General Information  Top
Target ID T68383 Target Info
Target Name Bone morphogenetic protein 2 (BMP2)
Synonyms Bone morphogenetic protein 2A; BMP2A; BMP-2A; BMP-2
Target Type Clinical trial Target
Gene Name BMP2
Biochemical Class Growth factor
UniProt ID
P12643
The microRNAs (miRNAs) Regulating This Target  Top
miRNA Mature ID hsa-miR-17-5p miRNA Info
miRNA Mature AC
MIMAT0000070
Sequence caaagugcuuacagugcagguag
miRNA Species Homo sapiens
Regulation Mechanism BMP2 is the target of miR-17-5p. [1]
Evidence Score (E-score) 2 +
1 Luciferase Reporter Assay; Western Blot [1]
2 qRT-PCR [2]
Representative Target(s) Regulated by This miRNA Amyloid beta A4 protein (APP) Target Info
A4_HUMAN
Apoptosis mediating surface antigen FAS (FAS) Target Info
TNR6_HUMAN
miRNA Mature ID hsa-miR-106a-5p miRNA Info
miRNA Mature AC
MIMAT0000103
Sequence aaaagugcuuacagugcagguag
miRNA Species Homo sapiens
Regulation Mechanism BMP2 is the target of miR-106a. [1]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [1]
Representative Target(s) Regulated by This miRNA Amyloid beta A4 protein (APP) Target Info
A4_HUMAN
Apoptosis mediating surface antigen FAS (FAS) Target Info
TNR6_HUMAN
miRNA Mature ID hsa-miR-106b-3p miRNA Info
miRNA Mature AC
MIMAT0004672
Sequence ccgcacuguggguacuugcugc
miRNA Species Homo sapiens
Regulation Mechanism miR-106b inhibited osteoblastic differentiation and bone formation partly through directly targeting bone morphogenetic protein 2 (BMP2). [3]
Evidence Score (E-score) 1 +
1 qRT-PCR; Western Blot [3]
Representative Target(s) Regulated by This miRNA Bone morphogenetic protein 2 (BMP2) Target Info
BMP2_HUMAN
Phosphatase and tensin homolog (PTEN) Target Info
PTEN_HUMAN
References  Top
REF 1 miR-17-5p and miR-106a are involved in the balance between osteogenic and adipogenic differentiation of adipose-derived mesenchymal stem cells. Stem Cell Res. 2013 May;10(3):313-24.
REF 2 Long non-coding RNA HOTAIR inhibits miR-17-5p to regulate osteogenic differentiation and proliferation in non-traumatic osteonecrosis of femoral head. PLoS One. 2017 Feb 16;12(2):e0169097.
REF 3 Silencing miR-106b accelerates osteogenesis of mesenchymal stem cells and rescues against glucocorticoid-induced osteoporosis by targeting BMP2. Bone. 2017 Apr;97:130-138.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.