Target Regulator(s) Information (MicroRNA)

Content Navigation (  All   None )                                      
Target General Information
The microRNAs (miRNAs) Regulating This Target
References
Target General Information  Top
Target ID T71907 Target Info
Target Name Survival motor neuron protein (SMN1)
Synonyms SMNT; SMNC; SMN2; SMN; Gemin-1; Component of gems 1
Target Type Successful Target
Gene Name SMN1
UniProt ID
Q16637
The microRNAs (miRNAs) Regulating This Target  Top
miRNA Mature ID hsa-miR-146a-5p miRNA Info
miRNA Mature AC
MIMAT0000449
Sequence ugagaacugaauuccauggguu
miRNA Species Homo sapiens
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [1]
Representative Target(s) Regulated by This miRNA Activation B7-1 antigen (CD80) Target Info
CD80_HUMAN
Apoptosis mediating surface antigen FAS (FAS) Target Info
TNR6_HUMAN
miRNA Mature ID hsa-miR-21-5p miRNA Info
miRNA Mature AC
MIMAT0000076
Sequence uagcuuaucagacugauguuga
miRNA Species Homo sapiens
Regulation Mechanism Further study using a reporter gene assay demonstrated Smad7 was a direct target of miR-21. [2]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [2]
Representative Target(s) Regulated by This miRNA Apoptosis antigen ligand (CD178) Target Info
TNFL6_HUMAN
Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
References  Top
REF 1 Increased miR-146a in gastric cancer directly targets SMAD4 and is involved in modulating cell proliferation and apoptosis. Oncol Rep. 2012 Feb;27(2):559-66.
REF 2 MicroRNA-21 in scleroderma fibrosis and its function in TGF--regulated fibrosis-related genes expression. J Clin Immunol. 2013 Aug;33(6):1100-9.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.