Content Navigation
( All
None )
Target General Information |
Top |
Target ID |
T72841 |
Target Info
|
Target Name |
Estrogen-related receptor-alpha (ESRRA) |
Synonyms |
Nuclear receptor subfamily 3 group B member 1; NR3B1; Estrogen-relatedreceptor, alpha; Estrogen-relatedreceptor alpha; Estrogen-related receptor alpha; Estrogen receptor-like 1; ESRL1; ERRalpha; ERR1; ERR-alpha |
Target Type |
Successful Target |
Gene Name |
ESRRA |
Biochemical Class |
Nuclear hormone receptor |
UniProt ID |
|
The microRNAs (miRNAs) Regulating This Target |
Top |
miRNA Mature ID |
hsa-miR-125a-5p |
miRNA Info
|
miRNA Mature AC |
|
Sequence |
ucccugagacccuuuaaccuguga
|
miRNA Species |
Homo sapiens |
Regulation Mechanism |
A significantly reduced luciferase reporter activity in cells co-transfected with pmiR- 125a 3' UTR. |
[1] |
Evidence Score (E-score) |
1 |
+ |
1 |
Luciferase Reporter Assay; Western Blot |
[1] |
Representative Target(s) Regulated by This miRNA |
Apoptosis regulator BAK (BAK)
|
Target Info
|
|
Apoptosis regulator Bcl-2 (BCL-2)
|
Target Info
|
|
miRNA Mature ID |
hsa-miR-497-5p |
miRNA Info
|
miRNA Mature AC |
|
Sequence |
cagcagcacacugugguuugu
|
miRNA Species |
Homo sapiens |
Regulation Mechanism |
miR-497 directly targeted ESRRA in breast cancer cells. |
[2] |
Evidence Score (E-score) |
1 |
+ |
1 |
Luciferase Reporter Assay; Western Blot |
[2] |
Representative Target(s) Regulated by This miRNA |
Angiomotin (AMOT)
|
Target Info
|
|
Apoptosis inhibitor survivin (BIRC5)
|
Target Info
|
|
References |
Top |
REF 1 |
MicroRNA-125a reduces proliferation and invasion of oral squamous cell carcinoma cells by targeting estrogen-related receptor : implications for cancer therapeutics. J Biol Chem. 2014 Nov 14;289(46):32276-90.
|
REF 2 |
MicroRNA-497 downregulation contributes to cell proliferation, migration, and invasion of estrogen receptor alpha negative breast cancer by targeti... Tumour Biol. 2016 Oct;37(10):13205-13214.
|
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.