Content Navigation
( All
None )
| Target General Information |
Top |
| Target ID |
T73756 |
Target Info
|
| Target Name |
Ephrin type-B receptor 2 (EPHB2) |
| Synonyms |
hEK5; Tyrosine-protein kinase receptor EPH-3; Tyrosine-protein kinase TYRO5; TYRO5; Renal carcinoma antigen NY-REN-47; Receptor protein-tyrosine kinase HEK5; EphB2 receptor tyrosine kinase; EphB2; EPTH3; EPHT3; EPH-like kinase 5; EPH tyrosine kinase 3; ELK-related tyrosine kinase; EK5; Developmentally-regulated Eph-related tyrosine kinase; DRT |
| Target Type |
Clinical trial Target |
| Gene Name |
EPHB2 |
| Biochemical Class |
Kinase |
| UniProt ID |
|
| The microRNAs (miRNAs) Regulating This Target |
Top |
| miRNA Mature ID |
hsa-miR-185-5p |
miRNA Info
|
| miRNA Mature AC |
|
| Sequence |
uggagagaaaggcaguuccuga
|
| miRNA Species |
Homo sapiens |
| Regulation Mechanism |
miR-185 directly targeted to EPHB2 mRNA and suppressed its expression. |
[1] |
| Evidence Score (E-score) |
2 |
+ |
| 1 |
ELISA; Luciferase Reporter Assay |
[1] |
| 2 |
Luciferase Reporter Assay |
[2] |
| Representative Target(s) Regulated by This miRNA |
Androgen receptor (AR)
|
Target Info
|
|
|
Arachidonate 12-lipoxygenase (12-LOX)
|
Target Info
|
|
| References |
Top |
| REF 1 |
Regulation of microcystin-LR-induced toxicity in mouse spermatogonia by miR-96. Environ Sci Technol. 2014 Jun 3;48(11):6383-90.
|
| REF 2 |
EphB2 contributes to human naive B-cell activation and is regulated by miR-185. FASEB J. 2014 Aug;28(8):3609-17.
|
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.
