Target Regulator(s) Information (MicroRNA)

Content Navigation (  All   None )                                      
Target General Information
The microRNAs (miRNAs) Regulating This Target
References
Target General Information  Top
Target ID T76198 Target Info
Target Name Thromboxane A2 receptor (TBXA2R)
Synonyms TXA2-R; TXA2 receptor; Prostanoid TP receptor
Target Type Successful Target
Gene Name TBXA2R
Biochemical Class GPCR rhodopsin
UniProt ID
P21731
The microRNAs (miRNAs) Regulating This Target  Top
miRNA Mature ID hsa-miR-31-5p miRNA Info
miRNA Mature AC
MIMAT0000089
Sequence aggcaagaugcuggcauagcu
miRNA Species Homo sapiens
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [1]
Representative Target(s) Regulated by This miRNA Cyclin-dependent kinase 1 (CDK1) Target Info
CDK1_HUMAN
Dickkopf-related protein 1 (DKK1) Target Info
DKK1_HUMAN
References  Top
REF 1 Deficiency of the microRNA-31-microRNA-720 pathway in the plasma and endothelial progenitor cells from patients with coronary artery disease. Arterioscler Thromb Vasc Biol. 2014 Apr;34(4):857-69.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.