Target Regulator(s) Information (MicroRNA)

Content Navigation (  All   None )                                      
Target General Information
The microRNAs (miRNAs) Regulating This Target
References
Target General Information  Top
Target ID T77664 Target Info
Target Name Interferon-gamma (IFNG)
Synonyms Interferon gamma; Immune interferon; IFN-gamma
Target Type Successful Target
Gene Name IFNG
Biochemical Class Cytokine: interferon
UniProt ID
P01579
The microRNAs (miRNAs) Regulating This Target  Top
miRNA Mature ID hsa-miR-125a-5p miRNA Info
miRNA Mature AC
MIMAT0000443
Sequence ucccugagacccuuuaaccuguga
miRNA Species Homo sapiens
Regulation Mechanism miR-125a which was significantly downregulated in PTSD patients, can bind to 3'-untranslated region (3'UTR) of IFNG mRNA. [1]
Evidence Score (E-score) 2 +
1 ELISA; Western Blot [1]
2 Luciferase Reporter Assay; Immunoblot [2]
Representative Target(s) Regulated by This miRNA Apoptosis regulator BAK (BAK) Target Info
BAK_HUMAN
Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
miRNA Mature ID hsa-miR-27a-3p miRNA Info
miRNA Mature AC
MIMAT0000084
Sequence uucacaguggcuaaguuccgc
miRNA Species Homo sapiens
Regulation Mechanism IFNG mRNAs showed repression after transient transfection of miR-27. [3]
Evidence Score (E-score) 2 +
1 Luciferase Reporter Assay [3]
2 qPCR [4]
Representative Target(s) Regulated by This miRNA ATP-binding cassette transporter A1 (ABCA1) Target Info
ABCA1_HUMAN
Cellular tumor antigen p53 (TP53) Target Info
P53_HUMAN
miRNA Mature ID hsa-miR-15a-5p miRNA Info
miRNA Mature AC
MIMAT0000068
Sequence uagcagcacauaaugguuugug
miRNA Species Homo sapiens
Regulation Mechanism miR-15a targets the IFNG 3'UTR. [5]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay [5]
Representative Target(s) Regulated by This miRNA Amyloid beta A4 protein (APP) Target Info
A4_HUMAN
Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
miRNA Mature ID hsa-miR-15b-5p miRNA Info
miRNA Mature AC
MIMAT0000417
Sequence uagcagcacaucaugguuuaca
miRNA Species Homo sapiens
Regulation Mechanism miR-15b targets the IFNG 3'UTR. [5]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay [5]
Representative Target(s) Regulated by This miRNA Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
Checkpoint kinase-1 (CHK1) Target Info
CHK1_HUMAN
miRNA Mature ID hsa-miR-409-3p miRNA Info
miRNA Mature AC
MIMAT0001639
Sequence gaauguugcucggugaaccccu
miRNA Species Homo sapiens
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay [6]
Representative Target(s) Regulated by This miRNA Angiogenin (ANG) Target Info
ANGI_HUMAN
Fibrinogen (FGG) Target Info
FIBG_HUMAN
References  Top
REF 1 Dysregulation in microRNA expression is associated with alterations in immune functions in combat veterans with post-traumatic stress disorder. PLoS One. 2014 Apr 23;9(4):e94075.
REF 2 MiR-125a targets effector programs to stabilize Treg-mediated immune homeostasis. Nat Commun. 2015 May 12;6:7096.
REF 3 Alternative capture of noncoding RNAs or protein-coding genes by herpesviruses to alter host T cell function. Mol Cell. 2014 Apr 10;54(1):67-79.
REF 4 The miR-27a-calreticulin axis affects drug-induced immunogenic cell death in human colorectal cancer cells. Cell Death Dis. 2016 Feb 25;7:e2108.
REF 5 MicroRNA-deficient NK cells exhibit decreased survival but enhanced function. J Immunol. 2012 Apr 1;188(7):3019-30.
REF 6 Reduced expression of MIR409-3p in primary immune thrombocytopenia. Br J Haematol. 2013 Apr;161(1):128-35.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.