Content Navigation
( All
None )
| Target General Information |
Top |
| Target ID |
T78019 |
Target Info
|
| Target Name |
Protein tyrosine phosphatase IVA 3 (PRL-3) |
| Synonyms |
Protein-tyrosine phosphatase of regenerating liver 3; Protein-tyrosine phosphatase 4a3; Protein tyrosine phosphatase type IVA 3; PRL3; PRL-3 |
| Target Type |
Literature-reported Target |
| Gene Name |
PTP4A3 |
| Biochemical Class |
Phosphoric monoester hydrolase |
| UniProt ID |
|
| The microRNAs (miRNAs) Regulating This Target |
Top |
| miRNA Mature ID |
hsa-miR-495-3p |
miRNA Info
|
| miRNA Mature AC |
|
| Sequence |
aaacaaacauggugcacuucuu
|
| miRNA Species |
Homo sapiens |
| Regulation Mechanism |
miR-495 acts as tumor suppressors by targeting the PRL-3 oncogene and inhibiting gastric cancer cell migration and invasion. |
[1] |
| Evidence Score (E-score) |
1 |
+ |
| 1 |
qRT-PCR; Western Blot |
[1] |
| Representative Target(s) Regulated by This miRNA |
Endoplasmic reticulum chaperone BiP (HSPA5)
|
Target Info
|
|
|
Forkhead box protein C1 (FOXC1)
|
Target Info
|
|
| miRNA Mature ID |
hsa-miR-551a |
miRNA Info
|
| miRNA Mature AC |
|
| Sequence |
gcgacccacucuugguuucca
|
| miRNA Species |
Homo sapiens |
| Regulation Mechanism |
miR-551a acts as tumor suppressors by targeting the PRL-3 oncogene and inhibiting gastric cancer cell migration and invasion. |
[1] |
| Evidence Score (E-score) |
1 |
+ |
| 1 |
qRT-PCR; Western Blot |
[1] |
| Representative Target(s) Regulated by This miRNA |
Protein tyrosine phosphatase IVA 3 (PRL-3)
|
Target Info
|
|
| References |
Top |
| REF 1 |
miR-495 and miR-551a inhibit the migration and invasion of human gastric cancer cells by directly interacting with PRL-3. Cancer Lett. 2012 Oct 1;323(1):41-7.
|
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.
