The microRNAs (miRNAs) Regulating This Target |
Top |
miRNA Mature ID |
hsa-miR-195-5p |
miRNA Info
|
miRNA Mature AC |
|
Sequence |
uagcagcacagaaauauuggc
|
miRNA Species |
Homo sapiens |
Evidence Score (E-score) |
2 |
+ |
1 |
Luciferase Reporter Assay |
[1] |
2 |
Luciferase Reporter Assay; Western Blot |
[2] |
Representative Target(s) Regulated by This miRNA |
ADP-ribosylation factor-like protein 2 (ARL2)
|
Target Info
|
|
Apoptosis inhibitor survivin (BIRC5)
|
Target Info
|
|
miRNA Mature ID |
hsa-miR-200b-3p |
miRNA Info
|
miRNA Mature AC |
|
Sequence |
uaauacugccugguaaugauga
|
miRNA Species |
Homo sapiens |
Regulation Mechanism |
Direct targets of miR-200b are VEGF and its receptors, Flt1 and KDR, which play a pivotal role in VEGF signaling. |
[4] |
Evidence Score (E-score) |
2 |
+ |
1 |
Luciferase Reporter Assay; qRT-PCR; Western Blot |
[3] |
2 |
Luciferase Reporter Assay; Western Blot |
[4] |
Representative Target(s) Regulated by This miRNA |
Apoptosis regulator Bcl-2 (BCL-2)
|
Target Info
|
|
CDK inhibitor 1B p27Kip1 (CDKN1B)
|
Target Info
|
|
miRNA Mature ID |
hsa-miR-200c-3p |
miRNA Info
|
miRNA Mature AC |
|
Sequence |
uaauacugccggguaaugaugga
|
miRNA Species |
Homo sapiens |
Regulation Mechanism |
miR-200c radiosensitized A549 cells by targeting VEGF-VEGFR2 pathway specifically, thus leading to inhibition of its downstream pro-survival signaling transduction and angiogenesis. |
[5] |
Evidence Score (E-score) |
2 |
+ |
1 |
Luciferase Reporter Assay; Western Blot |
[5] |
2 |
Western Blot |
[6] |
Representative Target(s) Regulated by This miRNA |
Activin receptor type IIB (ACVR2B)
|
Target Info
|
|
Apoptosis regulator Bcl-2 (BCL-2)
|
Target Info
|
|
miRNA Mature ID |
hsa-miR-296-5p |
miRNA Info
|
miRNA Mature AC |
|
Sequence |
agggcccccccucaauccugu
|
miRNA Species |
Homo sapiens |
Regulation Mechanism |
mRNA and protein levels of VEGFR2 were significantly increased with introduction of miR-296. |
[8] |
Evidence Score (E-score) |
2 |
+ |
1 |
Luciferase Reporter Assay |
[7] |
2 |
qRT-PCR; Western Blot |
[8] |
Representative Target(s) Regulated by This miRNA |
Apoptosis regulator Bcl-2 (BCL-2)
|
Target Info
|
|
Bcl-2-binding component 3 (BBC3)
|
Target Info
|
|
miRNA Mature ID |
hsa-miR-15b-5p |
miRNA Info
|
miRNA Mature AC |
|
Sequence |
uagcagcacaucaugguuuaca
|
miRNA Species |
Homo sapiens |
Regulation Mechanism |
miR-15b suppresses the expression of KDR transcript through targeting its 3'UTR region. |
[9] |
Evidence Score (E-score) |
1 |
+ |
1 |
Luciferase Reporter Assay; Western Blot |
[9] |
Representative Target(s) Regulated by This miRNA |
Apoptosis regulator Bcl-2 (BCL-2)
|
Target Info
|
|
Checkpoint kinase-1 (CHK1)
|
Target Info
|
|
miRNA Mature ID |
hsa-miR-17-3p |
miRNA Info
|
miRNA Mature AC |
|
Sequence |
acugcagugaaggcacuuguag
|
miRNA Species |
Homo sapiens |
Regulation Mechanism |
miR-17-3p is a negative regulator of the angiogenic phenotype of ECs through its ability to modulate the expression of Flk-1,. |
[10] |
Evidence Score (E-score) |
1 |
+ |
1 |
Luciferase Reporter Assay; Western Blot |
[10] |
Representative Target(s) Regulated by This miRNA |
E-selectin (SELE)
|
Target Info
|
|
Integrin alpha-5 (ITGA5)
|
Target Info
|
|
miRNA Mature ID |
hsa-miR-19b-1-5p |
miRNA Info
|
miRNA Mature AC |
|
Sequence |
aguuuugcagguuugcauccagc
|
miRNA Species |
Homo sapiens |
Evidence Score (E-score) |
1 |
+ |
1 |
Luciferase Reporter Assay |
[11] |
Representative Target(s) Regulated by This miRNA |
Caspase-8 (CASP8)
|
Target Info
|
|
Fibroblast growth factor receptor 2 (FGFR2)
|
Target Info
|
|
miRNA Mature ID |
hsa-miR-1236-3p |
miRNA Info
|
miRNA Mature AC |
|
Sequence |
ccucuuccccuugucucuccag
|
miRNA Species |
Homo sapiens |
Evidence Score (E-score) |
1 |
+ |
1 |
qRT-PCR; Western Blot |
[12] |
Representative Target(s) Regulated by This miRNA |
Nuclear receptor ROR-gamma (RORG)
|
Target Info
|
|
Vascular endothelial growth factor receptor 2 (KDR)
|
Target Info
|
|