Content Navigation
( All
None )
Target General Information |
Top |
Target ID |
T81658 |
Target Info
|
Target Name |
Matrix metalloproteinase-15 (MMP-15) |
Synonyms |
SMCP-2; Membrane-type-2 matrix metalloproteinase; Membrane-type matrix metalloproteinase 2; MTMMP2; MT2MMP; MT2-MMP; MT-MMP 2 |
Target Type |
Literature-reported Target |
Gene Name |
MMP15 |
Biochemical Class |
Peptidase |
UniProt ID |
|
The microRNAs (miRNAs) Regulating This Target |
Top |
miRNA Mature ID |
hsa-miR-29c-3p |
miRNA Info
|
miRNA Mature AC |
|
Sequence |
uagcaccauuugaaaucgguua
|
miRNA Species |
Homo sapiens |
Evidence Score (E-score) |
1 |
+ |
1 |
Luciferase Reporter Assay |
[1] |
Representative Target(s) Regulated by This miRNA |
Apoptosis regulator Bcl-2 (BCL-2)
|
Target Info
|
|
B7 homolog 3 (CD276)
|
Target Info
|
|
References |
Top |
REF 1 |
MicroRNAs profiling in murine models of acute and chronic asthma: a relationship with mRNAs targets. PLoS One. 2011 Jan 28;6(1):e16509.
|
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.