Target Regulator(s) Information (MicroRNA)

Content Navigation (  All   None )                                      
Target General Information
The microRNAs (miRNAs) Regulating This Target
References
Target General Information  Top
Target ID T81658 Target Info
Target Name Matrix metalloproteinase-15 (MMP-15)
Synonyms SMCP-2; Membrane-type-2 matrix metalloproteinase; Membrane-type matrix metalloproteinase 2; MTMMP2; MT2MMP; MT2-MMP; MT-MMP 2
Target Type Literature-reported Target
Gene Name MMP15
Biochemical Class Peptidase
UniProt ID
P51511
The microRNAs (miRNAs) Regulating This Target  Top
miRNA Mature ID hsa-miR-29c-3p miRNA Info
miRNA Mature AC
MIMAT0000681
Sequence uagcaccauuugaaaucgguua
miRNA Species Homo sapiens
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay [1]
Representative Target(s) Regulated by This miRNA Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
B7 homolog 3 (CD276) Target Info
CD276_HUMAN
References  Top
REF 1 MicroRNAs profiling in murine models of acute and chronic asthma: a relationship with mRNAs targets. PLoS One. 2011 Jan 28;6(1):e16509.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.