Content Navigation
( All
None )
| Target General Information |
Top |
| Target ID |
T82848 |
Target Info
|
| Target Name |
Protein-tyrosine phosphatase pez (PTPN14) |
| Synonyms |
Tyrosine-protein phosphatase non-receptor type 14; PTPD2; PEZ |
| Target Type |
Literature-reported Target |
| Gene Name |
PTPN14 |
| Biochemical Class |
Phosphoric monoester hydrolase |
| UniProt ID |
|
| The microRNAs (miRNAs) Regulating This Target |
Top |
| miRNA Mature ID |
hsa-miR-21-5p |
miRNA Info
|
| miRNA Mature AC |
|
| Sequence |
uagcuuaucagacugauguuga
|
| miRNA Species |
Homo sapiens |
| Evidence Score (E-score) |
2 |
+ |
| 1 |
Immunohistochemistry; Luciferase Reporter Assay; qRT-PCR; Western Blot |
[1] |
| 2 |
Microarray |
[2] |
| Representative Target(s) Regulated by This miRNA |
Apoptosis antigen ligand (CD178)
|
Target Info
|
|
|
Apoptosis regulator Bcl-2 (BCL-2)
|
Target Info
|
|
| References |
Top |
| REF 1 |
MiR-21 promotes intrahepatic cholangiocarcinoma proliferation and growth in vitro and in vivo by targeting PTPN14 and PTEN. Oncotarget. 2015 Mar 20;6(8):5932-46.
|
| REF 2 |
Downregulation of miR-21 inhibits EGFR pathway and suppresses the growth of human glioblastoma cells independent of PTEN status. Lab Invest. 2010 Feb;90(2):144-55.
|
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.
