Target Regulator(s) Information (MicroRNA)

Content Navigation (  All   None )                                      
Target General Information
The microRNAs (miRNAs) Regulating This Target
References
Target General Information  Top
Target ID T83797 Target Info
Target Name Hepatocyte growth factor (HGF)
Synonyms Scatter factor; SF; Hepatopoietin-A; Hepatopoeitin A; HPTA
Target Type Clinical trial Target
Gene Name HGF
Biochemical Class Peptidase
UniProt ID
P14210
The microRNAs (miRNAs) Regulating This Target  Top
miRNA Mature ID hsa-miR-26b-5p miRNA Info
miRNA Mature AC
MIMAT0000083
Sequence uucaaguaauucaggauaggu
miRNA Species Homo sapiens
Regulation Mechanism miR-26b directly targets the 3'-untranslated region (UTR) of HGF mRNA. [1]
Evidence Score (E-score) 2 +
1 ELISA; Luciferase Reporter Assay; Western Blot [1]
2 Western Blot [2]
Representative Target(s) Regulated by This miRNA ATP-binding cassette transporter A1 (ABCA1) Target Info
ABCA1_HUMAN
Collagen I (COL1A2) Target Info
CO1A2_HUMAN
miRNA Mature ID hsa-miR-200a-3p miRNA Info
miRNA Mature AC
MIMAT0000682
Sequence uaacacugucugguaacgaugu
miRNA Species Homo sapiens
Regulation Mechanism Upregulation of miRNA-200a reduced expression of HGF protein. [3]
Evidence Score (E-score) 1 +
1 qRT-PCR; Western Blot [3]
Representative Target(s) Regulated by This miRNA Amphiregulin (AREG) Target Info
AREG_HUMAN
Beta-catenin (CTNNB1) Target Info
CTNB1_HUMAN
References  Top
REF 1 Exosome-delivered EGFR regulates liver microenvironment to promote gastric cancer liver metastasis. Nat Commun. 2017 Apr 10;8:15016.
REF 2 MiR-221 and miR-26b Regulate Chemotactic Migration of MSCs Toward HGF Through Activation of Akt and FAK. J Cell Biochem. 2016 Jun;117(6):1370-83.
REF 3 MiRNA-200a expression is inverse correlation with hepatocyte growth factor expression in stromal fibroblasts and its high expression predicts a good prognosis in patients with non-small cell lung cancer. Oncotarget. 2016 Jul 26;7(30):48432-48442.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.