Target Regulator(s) Information (MicroRNA)

Content Navigation (  All   None )                                      
Target General Information
The microRNAs (miRNAs) Regulating This Target
References
Target General Information  Top
Target ID T89458 Target Info
Target Name HepG2 glucose transporter (SLC2A1)
Synonyms Solute carrier family 2, facilitated glucose transporter member 1; HepG2 glucosetransporter; Glucose transporter type 1, erythrocyte/brain; GLUT1; GLUT-1
Target Type Preclinical Target
Gene Name SLC2A1
Biochemical Class Major facilitator
UniProt ID
P11166
The microRNAs (miRNAs) Regulating This Target  Top
miRNA Mature ID hsa-miR-132-3p miRNA Info
miRNA Mature AC
MIMAT0000426
Sequence uaacagucuacagccauggucg
miRNA Species Homo sapiens
Regulation Mechanism miR-132 represses Glut1 expression by directly targeting its 3' UTR. [1]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [1]
Representative Target(s) Regulated by This miRNA Brain-derived neurotrophic factor (BDNF) Target Info
BDNF_HUMAN
Cyclin A2 (CCNA2) Target Info
CCNA2_HUMAN
miRNA Mature ID hsa-miR-148b-3p miRNA Info
miRNA Mature AC
MIMAT0000759
Sequence ucagugcaucacagaacuuugu
miRNA Species Homo sapiens
Regulation Mechanism miR-148b suppresses glycolysis in gastric cancer through directly targeting SLC2A1. [2]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [2]
Representative Target(s) Regulated by This miRNA Activated leukocyte cell adhesionmolecule (ALCAM) Target Info
CD166_HUMAN
Activin receptor-like kinase 2 (ALK-2) Target Info
ACVR1_HUMAN
miRNA Mature ID hsa-miR-150-5p miRNA Info
miRNA Mature AC
MIMAT0000451
Sequence ucucccaacccuuguaccagug
miRNA Species Homo sapiens
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [3]
Representative Target(s) Regulated by This miRNA Apoptosis inhibitor survivin (BIRC5) Target Info
BIRC5_HUMAN
Beta-arrestin-2 (ARRB2) Target Info
ARRB2_HUMAN
miRNA Mature ID hsa-miR-22-3p miRNA Info
miRNA Mature AC
MIMAT0000077
Sequence aagcugccaguugaagaacugu
miRNA Species Homo sapiens
Regulation Mechanism The expression of SLC2A1 regulated by miR-22. [4]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [4]
Representative Target(s) Regulated by This miRNA 5-HT 2C receptor (HTR2C) Target Info
5HT2C_HUMAN
ATP-citrate synthase (ACLY) Target Info
ACLY_HUMAN
miRNA Mature ID hsa-miR-1291 miRNA Info
miRNA Mature AC
MIMAT0005881
Sequence uggcccugacugaagaccagcagu
miRNA Species Homo sapiens
Regulation Mechanism Loss of tumor suppressive miR-1291 enhanced RCC cell proliferation, migration and invasion through targeting SLC2A1/GLUT1. [5]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [5]
Representative Target(s) Regulated by This miRNA Endoplasmic reticulum to nucleus signaling 1 (ERN1) Target Info
ERN1_HUMAN
HepG2 glucose transporter (SLC2A1) Target Info
GTR1_HUMAN
References  Top
REF 1 miR-132 mediates a metabolic shift in prostate cancer cells by targeting Glut1. FEBS Open Bio. 2016 Jun 8;6(7):735-41.
REF 2 miR-148b inhibits glycolysis in gastric cancer through targeting SLC2A1. Cancer Med. 2017 Jun;6(6):1301-1310.
REF 3 CD46 Activation Regulates miR-150-Mediated Control of GLUT1 Expression and Cytokine Secretion in Human CD4+ T Cells. J Immunol. 2016 Feb 15;196(4):1636-45.
REF 4 miR-22 as a prognostic factor targets glucose transporter protein type 1 in breast cancer. Cancer Lett. 2015 Jan 28;356(2 Pt B):410-7.
REF 5 Tumor-suppressive microRNA-1291 directly regulates glucose transporter 1 in renal cell carcinoma. Cancer Sci. 2013 Nov;104(11):1411-9.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.