Target Regulator(s) Information (MicroRNA)

Content Navigation (  All   None )                                      
Target General Information
The microRNAs (miRNAs) Regulating This Target
References
Target General Information  Top
Target ID T93945 Target Info
Target Name Caveolin 1 (CAV1)
Synonyms Caveolin1; Caveolin-1; Cav-1
Target Type Literature-reported Target
Gene Name CAV1
Biochemical Class Caveolin protein
UniProt ID
Q03135
The microRNAs (miRNAs) Regulating This Target  Top
miRNA Mature ID hsa-miR-107 miRNA Info
miRNA Mature AC
MIMAT0000104
Sequence agcagcauuguacagggcuauca
miRNA Species Homo sapiens
Regulation Mechanism Cav-1, a critical component of lipid rafts, was a target of miR-107. [2]
Evidence Score (E-score) 2 +
1 Luciferase Report Assay; RT-PCR; Northern Blot [1]
2 Luciferase Reporter Assay; Western Blot [2]
Representative Target(s) Regulated by This miRNA Beta-secretase 1 (BACE1) Target Info
BACE1_HUMAN
Caveolin 1 (CAV1) Target Info
CAV1_HUMAN
miRNA Mature ID hsa-miR-192-5p miRNA Info
miRNA Mature AC
MIMAT0000222
Sequence cugaccuaugaauugacagcc
miRNA Species Homo sapiens
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [3]
Representative Target(s) Regulated by This miRNA Activated leukocyte cell adhesionmolecule (ALCAM) Target Info
CD166_HUMAN
Activin receptor type IIB (ACVR2B) Target Info
AVR2B_HUMAN
miRNA Mature ID hsa-miR-203a-3p miRNA Info
miRNA Mature AC
MIMAT0000264
Sequence gugaaauguuuaggaccacuag
miRNA Species Homo sapiens
Regulation Mechanism miR-203 being a direct regulator of translation through interaction with elements in the 3' UTRs of Cav-1. [4]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay [4]
Representative Target(s) Regulated by This miRNA Apoptosis inhibitor survivin (BIRC5) Target Info
BIRC5_HUMAN
Apoptosis regulator Bcl-W (BCL-W) Target Info
B2CL2_HUMAN
References  Top
REF 1 MicroRNAs 103 and 107 regulate insulin sensitivity. Nature. 2011 Jun 8;474(7353):649-53.
REF 2 miR-103/107 modulates multidrug resistance in human gastric carcinoma by downregulating Cav-1. Tumour Biol. 2015 Apr;36(4):2277-85.
REF 3 Docosahexaenoic acid modulates the enterocyte Caco-2 cell expression of microRNAs involved in lipid metabolism. J Nutr. 2014 May;144(5):575-85.
REF 4 MicroRNA-203 regulates caveolin-1 in breast tissue during caloric restriction. Cell Cycle. 2012 Apr 1;11(7):1291-5.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.