Target Regulator(s) Information (MicroRNA)

Content Navigation (  All   None )                                      
Target General Information
The microRNAs (miRNAs) Regulating This Target
References
Target General Information  Top
Target ID T94479 Target Info
Target Name Ribosomal protein S6 kinase beta-1 (S6K1)
Synonyms p70-S6K 1; p70 ribosomal S6 kinase alpha; p70 S6KA; p70 S6K-alpha; p70 S6 kinase alpha; Serine/threonine-protein kinase 14A; STK14A; S6K-beta-1; S6K; Ribosomal protein S6 kinase I; P70S6K1; P70-S6K; 70 kDa ribosomal protein S6 kinase 1
Target Type Clinical trial Target
Gene Name RPS6KB1
Biochemical Class Kinase
UniProt ID
P23443
The microRNAs (miRNAs) Regulating This Target  Top
miRNA Mature ID hsa-miR-145-5p miRNA Info
miRNA Mature AC
MIMAT0000437
Sequence guccaguuuucccaggaaucccu
miRNA Species Homo sapiens
Regulation Mechanism miR-145 is found to negatively regulate RPS6KB1 protein levels by directly targeting their 3' UTRs. The overexpression of RPS6KB1 restores the cell colony formation that are reduced by miR-145. [1]
Evidence Score (E-score) 2 +
1 Luciferase Reporter Assay [1]
2 Western Blot [2]
Representative Target(s) Regulated by This miRNA A proliferation-inducing ligand (APRIL) Target Info
TNF13_HUMAN
Alkaline phosphatase (ALPPL2) Target Info
PPBN_HUMAN
miRNA Mature ID hsa-miR-195-5p miRNA Info
miRNA Mature AC
MIMAT0000461
Sequence uagcagcacagaaauauuggc
miRNA Species Homo sapiens
Regulation Mechanism RPS6KB1 was identified as a novel direct target of miR-195. [3]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [3]
Representative Target(s) Regulated by This miRNA ADP-ribosylation factor-like protein 2 (ARL2) Target Info
ARL2_HUMAN
Apoptosis inhibitor survivin (BIRC5) Target Info
BIRC5_HUMAN
miRNA Mature ID hsa-miR-200c-3p miRNA Info
miRNA Mature AC
MIMAT0000617
Sequence uaauacugccggguaaugaugga
miRNA Species Homo sapiens
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay [4]
Representative Target(s) Regulated by This miRNA Activin receptor type IIB (ACVR2B) Target Info
AVR2B_HUMAN
Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
miRNA Mature ID hsa-miR-497-5p miRNA Info
miRNA Mature AC
MIMAT0002820
Sequence cagcagcacacugugguuugu
miRNA Species Homo sapiens
Regulation Mechanism The luciferase activities from the RPS6KB1 wild-type construct were inhibited upon overexpression of miR-497 and were induced by inhibition of miR-497. [5]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [5]
Representative Target(s) Regulated by This miRNA Angiomotin (AMOT) Target Info
AMOT_HUMAN
Apoptosis inhibitor survivin (BIRC5) Target Info
BIRC5_HUMAN
miRNA Mature ID hsa-miR-455-5p miRNA Info
miRNA Mature AC
MIMAT0003150
Sequence uaugugccuuuggacuacaucg
miRNA Species Homo sapiens
Evidence Score (E-score) 1 +
1 PAR-CLIP [6]
Representative Target(s) Regulated by This miRNA Ribosomal protein S6 kinase beta-1 (S6K1) Target Info
KS6B1_HUMAN
Suppressor of cytokine signaling 3 (SOCS3) Target Info
SOCS3_HUMAN
References  Top
REF 1 MiR-145 is downregulated in human ovarian cancer and modulates cell growth and invasion by targeting p70S6K1 and MUC1. Biochem Biophys Res Commun. 2013 Nov 29;441(4):693-700.
REF 2 Pomegranate polyphenolics reduce inflammation and ulceration in intestinal colitis-involvement of the miR-145/p70S6K1/HIF1 axis in vivo and in vitro. J Nutr Biochem. 2017 May;43:107-115.
REF 3 miR-195 Inhibits Tumor Progression by Targeting RPS6KB1 in Human Prostate Cancer. Clin Cancer Res. 2015 Nov 1;21(21):4922-34.
REF 4 The microRNA-200 family regulates pancreatic beta cell survival in type 2 diabetes. Nat Med. 2015 Jun;21(6):619-27.
REF 5 MiR-497 decreases cisplatin resistance in ovarian cancer cells by targeting mTOR/P70S6K1. Oncotarget. 2015 Sep 22;6(28):26457-71.
REF 6 TP53 regulates miRNA association with AGO2 to remodel the miRNA-mRNA interaction network. Genome Res. 2016 Mar;26(3):331-41.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.