Target Regulator(s) Information (MicroRNA)

Content Navigation (  All   None )                                      
Target General Information
The microRNAs (miRNAs) Regulating This Target
References
Target General Information  Top
Target ID T95400 Target Info
Target Name Immunoglobulin epsilon Fc receptor gamma (FCERG)
Synonyms IgE Fc receptor subunit gamma; High affinity immunoglobulin epsilon receptor subunit gamma; FceRI gamma; FcRgamma; Fc receptor gamma-chain
Target Type Successful Target
Gene Name FCER1G
Biochemical Class Immunoglobulin
UniProt ID
P30273
The microRNAs (miRNAs) Regulating This Target  Top
miRNA Mature ID hsa-miR-1225-3p miRNA Info
miRNA Mature AC
MIMAT0005573
Sequence ugagccccugugccgcccccag
miRNA Species Homo sapiens
Regulation Mechanism FCER1G is confirmed by qRT-PCR to be downregulated in miR-1225-3p transfected cells. [1]
Evidence Score (E-score) 1 +
1 Microarray [1]
Representative Target(s) Regulated by This miRNA Immunoglobulin epsilon Fc receptor gamma (FCERG) Target Info
FCERG_HUMAN
Protein-tyrosine phosphatase SHP-1 (PTPN6) Target Info
PTN6_HUMAN
References  Top
REF 1 Expression of regulatory platelet microRNAs in patients with sickle cell disease. PLoS One. 2013 Apr 12;8(4):e60932.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.