Target Regulator(s) Information (MicroRNA)

Content Navigation (  All   None )                                      
Target General Information
The microRNAs (miRNAs) Regulating This Target
References
Target General Information  Top
Target ID T95438 Target Info
Target Name Excitatory amino acid transporter 2 (SLC1A2)
Synonyms Solute carrier family 1 member 2; Sodium-dependent glutamate/aspartate transporter 2; Glutamate/aspartatetransporter II; Glutamate/aspartate transporter II; GLT1; EAAT2
Target Type Literature-reported Target
Gene Name SLC1A2
Biochemical Class Dicarboxylate/amino acid:cation symporter
UniProt ID
P43004
The microRNAs (miRNAs) Regulating This Target  Top
miRNA Mature ID hsa-miR-200c-3p miRNA Info
miRNA Mature AC
MIMAT0000617
Sequence uaauacugccggguaaugaugga
miRNA Species Homo sapiens
Regulation Mechanism SLC1A2 was a target of miR-200c-3p and both its mRNA and protein significantly decreased with age in liver biopsies and in hepatic centrilobular zone, respectively. [1]
Evidence Score (E-score) 1 +
1 Immunohistochemistry; Luciferase Reporter Assay [1]
Representative Target(s) Regulated by This miRNA Activin receptor type IIB (ACVR2B) Target Info
AVR2B_HUMAN
Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
miRNA Mature ID hsa-miR-31-5p miRNA Info
miRNA Mature AC
MIMAT0000089
Sequence aggcaagaugcuggcauagcu
miRNA Species Homo sapiens
Regulation Mechanism SLC1A2 was a target of miR-31-5p and both its mRNA and protein significantly decreased with age in liver biopsies and in hepatic centrilobular zone, respectively. [1]
Evidence Score (E-score) 1 +
1 Immunohistochemistry; Luciferase Reporter Assay [1]
Representative Target(s) Regulated by This miRNA Cyclin-dependent kinase 1 (CDK1) Target Info
CDK1_HUMAN
Dickkopf-related protein 1 (DKK1) Target Info
DKK1_HUMAN
References  Top
REF 1 Identification of miR-31-5p, miR-141-3p, miR-200c-3p, and GLT1 as human liver aging markers sensitive to donor-recipient age-mismatch in transplants. Aging Cell. 2017 Apr;16(2):262-272.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.