Target Regulator(s) Information (MicroRNA)

Content Navigation (  All   None )                                      
Target General Information
The microRNAs (miRNAs) Regulating This Target
References
Target General Information  Top
Target ID T95553 Target Info
Target Name ADP-ribosylation factor-like protein 2 (ARL2)
Synonyms ARFL2
Target Type Literature-reported Target
Gene Name ARL2
Biochemical Class Small GTPase
UniProt ID
P36404
The microRNAs (miRNAs) Regulating This Target  Top
miRNA Mature ID hsa-miR-214-3p miRNA Info
miRNA Mature AC
MIMAT0000271
Sequence acagcaggcacagacaggcagu
miRNA Species Homo sapiens
Regulation Mechanism miR-214 negatively regulates ARL2 expression by directly binding to its 3'UTR. [2]
Evidence Score (E-score) 2 +
1 Luciferase Reporter Assay; qRT-PCR; Western Blot [1]
2 Microarray [2]
Representative Target(s) Regulated by This miRNA Activating transcription factor 4 (ATF-4) Target Info
ATF4_HUMAN
ADP-ribosylation factor-like protein 2 (ARL2) Target Info
ARL2_HUMAN
miRNA Mature ID hsa-miR-195-5p miRNA Info
miRNA Mature AC
MIMAT0000461
Sequence uagcagcacagaaauauuggc
miRNA Species Homo sapiens
Regulation Mechanism ARL2 is a genuine target of miR-195 in hESC-NPCs. [3]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [3]
Representative Target(s) Regulated by This miRNA ADP-ribosylation factor-like protein 2 (ARL2) Target Info
ARL2_HUMAN
Apoptosis inhibitor survivin (BIRC5) Target Info
BIRC5_HUMAN
References  Top
REF 1 microRNA-214 functions as a tumor suppressor in human colon cancer via the suppression of ADP-ribosylation factor-like protein 2. Oncol Lett. 2015 Feb;9(2):645-650.
REF 2 MicroRNA-214 is aberrantly expressed in cervical cancers and inhibits the growth of HeLa cells. IUBMB Life. 2009 Nov;61(11):1075-82.
REF 3 MicroRNA-195 targets ADP-ribosylation factor-like protein 2 to induce apoptosis in human embryonic stem cell-derived neural progenitor cells. Cell Death Dis. 2013 Jun 27;4:e695.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.