Content Navigation
( All
None )
| Target General Information |
Top |
| Target ID |
T97765 |
Target Info
|
| Target Name |
Macrophage inflammatory protein 1-alpha (CCL3) |
| Synonyms |
Tonsillar lymphocyte LD78 alpha protein; Small-inducible cytokine A3; SIS-beta; SCYA3; PAT 464.1; Macrophage Inflammatory Protein-1alpha Nuclear Protein; MNP; MIP1A; MIP-1-alpha; G0S19-1 protein; G0S19-1; G0/G1 switch regulatory protein 19-1; C-C motif chemokine 3 |
| Target Type |
Clinical trial Target |
| Gene Name |
CCL3 |
| Biochemical Class |
Cytokine: CC chemokine |
| UniProt ID |
|
| The microRNAs (miRNAs) Regulating This Target |
Top |
| miRNA Mature ID |
hsa-miR-223-3p |
miRNA Info
|
| miRNA Mature AC |
|
| Sequence |
ugucaguuugucaaauacccca
|
| miRNA Species |
Homo sapiens |
| Regulation Mechanism |
miR-223 directly targets the chemoattractants CCL3. |
[1] |
| Evidence Score (E-score) |
1 |
+ |
| 1 |
Luciferase Reporter Assay |
[1] |
| Representative Target(s) Regulated by This miRNA |
ATM serine/threonine kinase (ATM)
|
Target Info
|
|
|
C-X-C motif chemokine 2 (CXCL2)
|
Target Info
|
|
| References |
Top |
| REF 1 |
MicroRNA-223 controls susceptibility to tuberculosis by regulating lung neutrophil recruitment. J Clin Invest. 2013 Nov;123(11):4836-48.
|
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.
