Target Regulator(s) Information (MicroRNA)

Content Navigation (  All   None )                                      
Target General Information
The microRNAs (miRNAs) Regulating This Target
References
Target General Information  Top
Target ID T99089 Target Info
Target Name Serine/threonine-protein kinase B-raf (BRAF)
Synonyms V-Raf murine sarcoma viral oncogene homolog B1; RAFB1; Proto-oncogene B-Raf; P94; BRAF1; BRAF(V599E); BRAF serine/threonine kinase; B-raf protein; B-Raf
Target Type Successful Target
Gene Name BRAF
Biochemical Class Kinase
UniProt ID
P15056
The microRNAs (miRNAs) Regulating This Target  Top
miRNA Mature ID hsa-miR-145-5p miRNA Info
miRNA Mature AC
MIMAT0000437
Sequence guccaguuuucccaggaaucccu
miRNA Species Homo sapiens
Regulation Mechanism Re-expression of BRAF can partially revert a decrease in transformation properties caused by the overexpression of miR- 145. [1]
Evidence Score (E-score) 2 +
1 Luciferase Reporter Assay; Western Blot [1]
2 qPCR [2]
Representative Target(s) Regulated by This miRNA A proliferation-inducing ligand (APRIL) Target Info
TNF13_HUMAN
Alkaline phosphatase (ALPPL2) Target Info
PPBN_HUMAN
miRNA Mature ID hsa-miR-143-3p miRNA Info
miRNA Mature AC
MIMAT0000435
Sequence ugagaugaagcacuguagcuc
miRNA Species Homo sapiens
Regulation Mechanism Re-expression of BRAF can partially revert a decrease in transformation properties caused by the overexpression of miR- 143. [1]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [1]
Representative Target(s) Regulated by This miRNA Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
Connective tissue growth factor (CTGF) Target Info
CTGF_HUMAN
miRNA Mature ID hsa-miR-579-3p miRNA Info
miRNA Mature AC
MIMAT0003244
Sequence uucauuugguauaaaccgcgauu
miRNA Species Homo sapiens
Regulation Mechanism Introduction of miR-579-3p in HEK-293 cells with the BRAF wild-type 3'UTR construct led to a significant inhibition of luciferase activity. [3]
Evidence Score (E-score) 1 +
1 qRT-PCR; Western Blot [3]
Representative Target(s) Regulated by This miRNA Serine/threonine-protein kinase B-raf (BRAF) Target Info
BRAF_HUMAN
References  Top
REF 1 Analysis of the combined action of miR-143 and miR-145 on oncogenic pathways in colorectal cancer cells reveals a coordinate program of gene repression. Oncogene. 2013 Oct;32(40):4806-13.
REF 2 Aberrant expression of miR-21, miR-376c and miR-145 and their target host genes in Merkel cell polyomavirus-positive non-small cell lung cancer. Oncotarget. 2016 Aug 11;8(68):112371-112383.
REF 3 miR-579-3p controls melanoma progression and resistance to target therapy. Proc Natl Acad Sci U S A. 2016 Aug 23;113(34):E5005-13.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.