Target Regulator(s) Information (MicroRNA)

Content Navigation (  All   None )                                      
Target General Information
The microRNAs (miRNAs) Regulating This Target
References
Target General Information  Top
Target ID T23191 Target Info
Target Name Orphan nuclear receptor DAX-1 (NR0B1)
Synonyms Nuclear receptor subfamily 0 group B member 1; Nuclear receptor DAX-1; DSS-AHC critical region on the X chromosome protein 1; DAX1; AHC
Target Type Literature-reported Target
Gene Name NR0B1
Biochemical Class Nuclear hormone receptor
UniProt ID
P51843
The microRNAs (miRNAs) Regulating This Target  Top
miRNA Mature ID hsa-miR-561-3p miRNA Info
miRNA Mature AC
MIMAT0003225
Sequence caaaguuuaagauccuugaagu
miRNA Species Homo sapiens
Regulation Mechanism Overexpression of miR-561 decreased NR0B1-3'UTR reporter activity. [1]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay [1]
Representative Target(s) Regulated by This miRNA Orphan nuclear receptor DAX-1 (NR0B1) Target Info
NR0B1_HUMAN
Proto-oncogene c-Myc (MYC) Target Info
MYC_HUMAN
References  Top
REF 1 MicroRNA-561 promotes acetaminophen-induced hepatotoxicity in HepG2 cells and primary human hepatocytes through downregulation of the nuclear receptor corepressor dosage-sensitive sex-reversal adrenal hypoplasia congenital critical region on the X chromosome, gene 1 (DAX-1). Drug Metab Dispos. 2014 Jan;42(1):44-61.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.