miRNA Details
| miRNA General Information | |||||
|---|---|---|---|---|---|
| miRNA Mature ID | hsa-miR-1256 | ||||
| miRNA Stemloop AC | MI0006390 | ||||
| miRNA Stemloop ID | hsa-mir-1256 | ||||
| Sequence | aggcauugacuucucacuagcu | ||||
| TTD Target(s) Regulated by This miRNA | Intercellular adhesion molecule ICAM-1 (ICAM1) | Successful Target | Target Info | [1] | |
| E-selectin (SELE) | Clinical trial Target | Target Info | [1] | ||
| Protein(s) Regulated by This miRNA | E3 ubiquitin-protein ligase TRIM68 | Regulated Protein | [2] | ||
| References | |||||
| REF 1 | Cutting edge: TNF-induced microRNAs regulate TNF-induced expression of E-selectin and intercellular adhesion molecule-1 on human endothelial cells: feedback control of inflammation. J Immunol. 2010 Jan 1;184(1):21-5. | ||||
| REF 2 | Epigenetic deregulation of miR-29a and miR-1256 by isoflavone contributes to the inhibition of prostate cancer cell growth and invasion.Epigenetics. 2012 Aug;7(8):940-9. | ||||
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.